assay metagenomics annotation template
Template for file-based Metagenomics annotations [Download]
| Attribute | Description | Required | columnType | DependsOn | Source | Parent | Valid Values |
|---|---|---|---|---|---|---|---|
| ModelSystemType | Type of model system | False | BOOLEAN | Sage Bionetworks | ManifestColumn | animal, cerebral organoid, immortalized cell line, iPSC, organoid, primary cell culture, Not assigned | |
| isModelSystem | Boolean flag indicating whether or not a file has data from a model system | True | BOOLEAN | Sage Bionetworks | ManifestColumn | True, False, Not assigned | |
| DNAextraction | DNA extraction kit method. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | True | STRING | ManifestColumn | |||
| adapters | Adapters provide priming sequences for both amplification and sequencing of the sample-library fragments. Both adapters should be reported; in uppercase letters. Example - 'AATGATACGGCGACCACCGAGATCTACACGCT; CAAGCAGAAGACGGCATACGAGAT'Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | True | STRING | ManifestColumn | |||
| analysisType | Type of analysis | False | STRING | Sage Bionetworks | ManifestColumn | ANOVA,batch effect correction,clustering,data normalization,de-novo assembly,dose response study,enrichment analysis,genome-wide association,mendelian randomization analysis,network analysis,polygenic risk scores, Not assigned | |
| assemblyName | Name/version of the assembly provided by the submitter used in the genome browsers and the community. Example - 'HuRef, JCVI_ISG_3_1.0'Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | True | STRING | ManifestColumn | |||
| assemblyQual | Assembly quality. The assembly quality category is based on sets of criteria outlined for each assembly quality category.High Quality- Multiple fragments where gaps span repetitive regions. Presence of the 23S, 16S and 5S rRNA genes and at least 18 tRNAs.Medium Quality- Many fragments with little to no review of assembly other than reporting of standard assembly statistics.Low Quality- Many fragments with little to no review of assembly other than reporting of standard assembly statistics. Assembly statistics include, but are not limited to, total assembly size, number of contigs, contig N50/L50, and maximum contig length. Example values - high-quality genome, medium-quality genome, low-quality genome | True | STRING | ManifestColumn | |||
| assemblySoftware | Tool(s) used for assembly, including version number and parameters. Example - 'metaSPAdes;3.11.0; kmer set 21,33,55,77,99,121, default parameters otherwise'. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | True | STRING | ManifestColumn | |||
| associatedResource | Relevant electronic resources. A related resource that is referenced, cited, or otherwise associated to the sequence. Example - 'http-//www.earthmicrobiome.org/'Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | True | STRING | ManifestColumn | |||
| consortium | The name of the consortium | True | STRING | Sage Bionetworks | ManifestColumn | ELITE, ELITE CDCP, Not assigned | |
| dataFile | Name of additional file(s) accompanying the data. The file(s) provide, for example, the name of any raw files generated by the instrument, generated reports from a vendor, an Rscript, or an instructions document. The files can be instrument raw files, converted peak lists such as mzML, MGF, or result files like mzIdentML. The files can be additional documentation submitted alongside the data needed for reuse and sharing purposes. Provide the file names of any additional files submitted alongside the data (ex., an ADAT file). Multiple file names can be separated by (;)Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | True | STRING | ManifestColumn | |||
| dataSubtype | Further qualification of dataType, which may be used to indicate the state of processing of the data, aggregation of the data, or presence of metadata | True | STRING | Sage Bionetworks | ManifestColumn | raw,processed,results,normalized,metadata, Not assigned | |
| dataType | The category or format of data generated or collected in an experiment, describing the kind of information the dataset contains (for example, genomics, imaging, proteomics, or behavioral data). | True | STRING_LIST | Sage Bionetworks | ManifestColumn | clinical,drugScreen,electrophysiology,epigenetics,geneExpression,genomeAssembly,genomicVariants,imaging,lipidomics,metabolomics,metagenomics,Not applicable,Not collected,Not specified,Other,phenotype,proteomics,Unknown,wearableData | |
| databaseLibrary | The name(s) of the associated database library. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | True | STRING | ManifestColumn | |||
| databaseName | The name of the search database (nr, SwissProt or est_human, and/or mass spectral library). Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | True | STRING | ManifestColumn | |||
| databaseSource | The name of the organization, project, or laboratory from where the database is obtained (UniProt, NCBI, EBI, other). | True | STRING | ManifestColumn | |||
| databaseVersion | The version of the database. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | True | STRING | ManifestColumn | |||
| databaseWeblink | An internet address that may provide details of a database or software search, as well as for labs that generate their own search method (web link). Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | True | STRING | ManifestColumn | |||
| experimentType | The type of experiment used. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | True | STRING | ManifestColumn | |||
| experimentalFactor | Variable aspects of an experiment design that can be used to describe an experiment or set of experiments in an increasingly detailed manner.This field accepts ontology terms from Experimental Factor Ontology (EFO) and/or Ontology for Biomedical Investigations (OBI). Example - 'time series design [EFO-0001779]'Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | True | STRING | ManifestColumn | |||
| fileFormat | Defined format of the data file, typically corresponding to extension, but sometimes indicating more general group of files produced by the same tool or software | True | STRING | Sage Bionetworks | ManifestColumn | FASTQ, FASTA, SAM, BAM, CRAM, VCF, BCF, GTF, GFF, GFF3, BED, BigBed, WIG, BigWig, CSV, TSV, MTX, H5AD, LOOM, RDS,PED, MAP, BED_PLINK, TPED, TFAM, BEDGRAPH, NARROWPEAK, BROADPEAK, TAGALIGN, OME-TIFF, ND2, CZI, LSM, H5, HDF5, PARQUET, PDB, MMCIF, JSON, YAML, XML, TXT, XLSX, CSV, Not assigned | |
| instrumentModel | The model of the instrument used. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | True | STRING | ManifestColumn | |||
| libLayout | Library layout. Specify whether to expect single, paired, or other configurations of reads. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | True | STRING | ManifestColumn | |||
| libReadsSeqd | Library reads sequenced. Total number of clones sequenced from the library. Example - '20'Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | True | INTEGER | ManifestColumn | |||
| libSize | Library size. Total number of clones in the library prepared for the project. Example - '50'Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | True | INTEGER | ManifestColumn | |||
| libVector | Library vector. Cloning vector type(s) used in the construction of libraries. Example - 'Bacteriophage P1'Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | True | STRING | ManifestColumn | |||
| measurementTechnique | The name of the measurement technique describing the assay method. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | True | STRING | ManifestColumn | Bisulfite sequencing,Clinical data,Genome-wide association study,High-performance liquid chromatography tandem mass spectrometry,Liquid chromatography mass spectrometry,Liquid chromatography tandem mass spectrometry,Mass spectrometry,Metabolomics,MetaX-processed metabolomics data,Proximity extension assay,RNA sequencing,Single-cell RNA sequencing,Shotgun metagenomic sequencing,Single nucleotide polymorphism array,Tandem Mass Tag proteomics,Whole-genome sequencing,Unknown,Other,Not collected,Not applicable,Not specified | ||
| mid | Multiplex identifiers. Molecular barcodes, called Multiplex Identifiers (MIDs), are used to tag unique samples in a sequencing run specifically. Sequence should be reported in uppercase letters. Example - 'GTGAATAT'Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | True | STRING | ManifestColumn | |||
| nucleAcidExt | Nucleic acid extraction. A link to a literature reference, electronic resource or a standard operating procedure (SOP), that describes the material separation to recover the nucleic acid fraction from a sample. (example, https-//mobio.com/media/wysiwyg/pdfs/protocols/12888.pdf). Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | True | STRING | ManifestColumn | |||
| numberContig | Number of contigs. Total number of contigs in the cleaned/submitted assembly that comprise a given genome, SAG, MAG, or UViG. Example - '40'Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | False | INTEGER | ManifestColumn | |||
| resourceType | The type of resource being stored and annotated | True | STRING | Sage Bionetworks | ManifestColumn | experimentalData,metadata,tool,analysis,computationalNotebook,softwareTool,Not assigned | |
| samplePrepProtocol | An internet address that may provide more details of the protocol information (web link). Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | True | STRING | ManifestColumn | |||
| seqMethod | Sequencing method. Sequencing method used; Example - 'Sanger, pyrosequencing, ABI-solid'. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | True | STRING | ManifestColumn | |||
| seqPlatform | Sequencing platform information. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | True | STRING | ManifestColumn | |||
| sop | Relevant standard operating procedures. Standard operating procedures used in the assembly and/or annotation of genomes, metagenomes, or environmental sequences. Example - 'http-//press.igsb.anl.gov/earthmicrobiome/protocols-and-standards/its/)'Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | True | STRING | ManifestColumn | |||
| sourceMatID | Source material identifiers. A unique identifier assigned to a material sample (as defined by http-//rs.tdwg.org/dwc/terms/materialSampleID and as opposed to a particular digital record of a material sample) used for extracting nucleic acids, and subsequent sequencing.The identifier can refer to the original material collected or any derived sub-samples. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | True | STRING | ManifestColumn | |||
| speciesGroup | The taxonomic ranking including both species and subspecies the individual belongs to. | True | STRING | ManifestColumn | Amphibian,Bird,Fish,Invertebrate,Mammal,Not applicable,Not collected,Not specified,Reptile,Unknown | ||
| speciesName | The scientific name of the species (typically a taxonomic group, ex. "Eremophila alpestris) the individual belongs to.""" | True | STRING | ManifestColumn | Abramis brama, Acanthisitta chloris, Accipiter cooperii, Accipiter gentilis, Accipiter nisus, Acipenser naccarii, Acipenser ruthenus, Acomys cahirinus, Acomys russatus, Acridotheres tristis, Actitis macularius, Aegithalos caudatus, Aix sponsa, Alca torda, Alligator mississippiensis, Alopochen aegyptiaca, Alosa sapidissima, Amblyraja radiata, Ammodramus caudacutus, Ammodytes marinus, Ammospiza nelsoni, Anabas testudineus, Anableps anableps, Anas acuta, Anas carolinensis, Anas crecca, Anas platyrhynchos, Anguilla anguilla, Anser albifrons, Anser anser, Anser brachyrhynchus, Anser erythropus, Anser fabalis, Antennarius maculatus, Antigone canadensis, Aplidium turbinatum, Aplochiton taeniatus, Apodemus sylvaticus, Apus apus, Aquila chrysaetos, Ara ararauna, Archilochus colubris, Archocentrus centrarchus, Argentina silus, Artibeus intermedius, Artibeus jamaicensis, Artibeus lituratus, Arvicanthis niloticus, Arvicola amphibius, Ascaphus truei, Ascidia mentula, Ascidiella aspersa, Astatotilapia calliptera, Asterias rubens, Athene noctua, Aythya ferina, Aythya fuligula, Aythya marila, Baeolophus bicolor, Balaena mysticetus, Balaenoptera acutorostrata, Balaenoptera borealis, Balaenoptera musculus, Balaenoptera physalus, Balearica regulorum, Barbatula barbatula, Barbus barbus, Bathysaurus mollis, Benthalbella elongata, Blarina brevicauda, Blennius ocellaris, Bombina bombina, Bombina variegata, Bombycilla cedrorum, Bonasa umbellus, Borostomias antarcticus, Bos taurus, Branchiostoma lanceolatum, Branta canadensis, Branta leucopsis, Bubo virginianus, Bucephala clangula, Bucorvus abyssinicus, Bufo bufo, Buglossidium luteum, Buteo buteo, Buteo jamaicensis, Buteo lineatus, Callithrix jacchus, Calonectris borealis, Calypte anna, Canis latrans, Canis lupus, Caprimulgus europaeus, Carassius carassius, Carcharodon carcharias, Cardinalis cardinalis, Caretta caretta, Cariama cristata, Carollia sowelli, Castor canadensis, Catharus ustulatus, Cavia porcellus, Cepola macrophthalma, Cervus elaphus, Cetorhinus maximus, Chanos chanos, Charadrius vociferus, Chelidonichthys cuculus, Chelidonichthys lucerna, Chelmon rostratus, Chelon labrosus, Chelonia mydas, Chinchilla lanigera, Chionoecetes opilio, Chionomys nivalis, Chiroxiphia lanceolata, Choloepus didactylus, Chroicocephalus ridibundus, Ciconia maguari, Ciliata mustela, Cinclus cinclus, Clangula hyemalis, Clavelina lepadiformis, Colius striatus, Coloeus monedula, Columba livia, Columba palumbus, Condylura cristata, Conger conger, Copsychus sechellarum, Coregonus lavaretus, Corella eumyota, Corvus brachyrhynchos, Corvus hawaiiensis, Corvus moneduloides, Cottoperca gobio, Cricetomys ansorgei, Cricetulus barabensis, Cricetulus griseus, Cryptomys damarensis, Cuculus canorus, Cuniculus paca, Cyanistes caeruleus, Cyanocitta cristata, Cyclopterus lumpus, Cygnus columbianus, Cygnus cygnus, Cygnus olor, Cynocephalus volans, Danio rerio, Dasypus novemcinctus, Delphinus delphis, Dendrocygna viduata, Dendropsophus ebraccatus, Denticeps clupeoides, Dermanura phaeotis, Dermochelys coriacea, Diceros bicornis, Diplecogaster bimaculata, Discoglossus pictus, Dromiciops gliroides, Dryobates pubescens, Dumetella carolinensis, Echeneis naucrates, Echiichthys vipera, Electrona antarctica, Electrona carlsbergi, Electrona subaspera, Electrophorus electricus, Elephas maximus, Ellobius lutescens, Ellobius talpinus, Emys orbicularis, Eonycteris spelaea, Eptesicus chiriquinus, Eptesicus furinalis, Eptesicus fuscus, Eptesicus nilssonii, Equus caballus, Eremophila alpestris, Erethizon dorsatum, Eretmochelys imbricata, Erinaceus europaeus, Erithacus rubecula, Erpetoichthys calabaricus, Erythrolamprus reginae, Eschrichtius robustus, Esox lucius, Eubalaena glacialis, Euleptes europaea, Eutrigla gurnardus, Falco biarmicus, Falco cherrug, Falco naumanni, Falco peregrinus, Falco punctatus, Falco rusticolus, Falco tinnunculus, Ficedula hypoleuca, Fringilla coelebs, Fukomys damarensis, Fulica atra, Fundulus diaphanus, Gadus morhua, Gaidropsarus vulgaris, Gallinula chloropus, Gallus gallus, Gardnerycteris keenani, Gasterosteus aculeatus, Gastrophryne carolinensis, Gavia stellata, Geothlypis trichas, Geotrypetes seraphini, Globicephala melas, Glossophaga mutica, Gobio gobio, Gobius niger, Gopherus evgoodei, Gopherus flavomarginatus, Gouania willdenowi, Grampus griseus, Grus americana, Grus grus, Gulosus aristotelis, Gymnoscopelus braueri, Gymnoscopelus microlampas, Gypaetus barbatus, Haematopus ostralegus, Haemorhous mexicanus, Haliaeetus albicilla, Halichoerus grypus, Harpagifer antarcticus, Harpia harpyja, Hemiprocne comata, Hemiscyllium ocellatum, Heterocephalus glaber, Heterohyrax brucei, Hippoglossus hippoglossus, Hipposideros larvatus, Hirundo rustica, Homo sapiens, Hoplias malabaricus, Hydrochoerus hydrochaeris, Hydroprogne caspia, Hylocichla mustelina, Hypanus sabinus, Hyperolius riggenbachi, Hyperoodon ampullatus, Hyperoplus immaculatus, Hypomesus transpacificus, Ia io, Icteria virens, Jaculus jaculus, Labrus bergylta, Labrus mixtus, Lacerta agilis, Lagenorhynchus acutus, Lagenorhynchus albirostris, Lampanyctus macdonaldi, Lampetra fluviatilis, Larus argentatus, Larus canus, Larus delawarensis, Larus fuscus, Larus glaucescens, Larus marinus, Larus michahellis, Larus occidentalis, Lathamus discolor, Lemur catta, Lepidochelys kempii, Leptodactylus fuscus, Leuciscus leuciscus, Liasis olivaceus, Limanda limanda, Lipophrys pholis, Lissotriton helveticus, Lissotriton vulgaris, Lophostoma evotis, Lutra lutra, Lynx canadensis, Macaca fascicularis, Macaca mulatta, Macropus eugenii, Malaclemys terrapin, Malacosteus niger, Manis pentadactyla, Mareca strepera, Marmota monax, Martes martes, Mastacembelus armatus, Megalops cyprinoides, Melanerpes carolinus, Melanostigma gelatinosum, Melanotaenia boesemani, Meleagris gallopavo, Meles meles, Melopsittacus undulatus, Melospiza georgiana, Melospiza melodia, Mergellus albellus, Mergus serrator, Meriones unguiculatus, Merops nubicus, Mesocricetus auratus, Mesoplodon bidens, Mesoplodon densirostris, Mesoplodon mirus, Microcaecilia unicolor, Microchirus variegatus, Micromesistius poutassou, Micromys minutus, Micronycteris microtis, Microstomus kitt, Microtus pennsylvanicus, Milvus milvus, Mimus polyglottos, Miniopterus schreibersii, Molossus alvarezi, Molossus molossus, Molossus nigricans, Molothrus ater, Monodelphis domestica, Multi-species, Muntiacus reevesi, Mus musculus, Muscardinus avellanarius, Mustela erminea, Mustela nivalis, Mustelus asterias, Myocastor coypus, Myodes glareolus, Myotis daubentonii, Myotis emarginatus, Myotis lucifugus, Myotis myotis, Myotis mystacinus, Myotis nattereri, Myotis nesopolus, Myotis pilosatibialis, Myotis tricolor, Myripristis murdjan, Myxine glutinosa, Nannobrachium achirus, Nannospalax galili, Nansenia antarctica, Natrix helvetica, Neoarius graeffei, Neofelis nebulosa, Neosciurus carolinensis, Neotoma cinerea, Neotoma floridana, Neovison vison, Nesoenas mayeri, Netta rufina, Nomonyx dominicus, Not applicable, Not collected, Not provided, Not specified, Notolabrus celidotus, Notolepis coatsi, Notothenia rossii, Numenius arquata, Nyctalus leisleri, Nyctibius grandis, Nycticebus coucang, Octodon degus, Odocoileus virginianus, Ondatra zibethicus, Ornithorhynchus anatinus, Oryctolagus cuniculus, Osmerus eperlanus, Osmerus mordax, Other, Otis tarda, Pagrus pagrus, Pan troglodytes, Pangasianodon hypophthalmus, Papio anubis, Parambassis ranga, Passer domesticus, Passerculus sandwichensis, Passerina caerulea, Passerina cyanea, Pelecanus crispus, Pelophylax lessonae, Periophthalmus magnuspinnatus, Peromyscus gossypinus, Peromyscus leucopus, Peromyscus maniculatus, Petromyzon marinus, Phaethon aethereus, Phalacrocorax auritus, Phalacrocorax carbo, Phasianus colchicus, Phocoena phocoena, Phocoena sinus, Phoenicopterus ruber, Pholidichthys leucotaenia, Pholis gunnellus, Phoxinus phoxinus, Phyllostomus discolor, Picoides villosus, Pipilo erythrophthalmus, Pipistrellus kuhlii, Pipistrellus nathusii, Pipistrellus pipistrellus, Pipistrellus pygmaeus, Platalea leucorodia, Platichthys flesus, Platyrrhinus helleri, Plecotus auritus, Pleuronectes platessa, Pluvialis apricaria, Podarcis bocagei, Podarcis cretensis, Podarcis filfolensis, Podarcis gaigeae, Podarcis liolepis, Podarcis melisellensis, Podarcis muralis, Podarcis pityusensis, Podarcis raffonei, Podarcis siculus, Podarcis tiliguerta, Podarcis vaucheri, Podargus strigoides, Poecile carolinensis, Pogoniulus pusillus, Pollachius pollachius, Porphyrio hochstetteri, Potamotrygon marinae, Pristis pectinata, Pseudophryne corroboree, Pseudorca crassidens, Pterocles gutturalis, Pygocentrus nattereri, Quiscalus quiscula, Rana temporaria, Rattus norvegicus, Rattus rattus, Regulus calendula, Rhea pennata, Rhinatrema bivittatum, Rhineura floridana, Rhinolophus ferrumequinum, Rhynochetos jubatus, Rissa tridactyla, Rousettus aegyptiacus, Saimiri boliviensis, Salarias fasciatus, Salmo trutta, Sayornis phoebe, Scalopus aquaticus, Scardinius erythrophthalmus, Scatophagus argus, Sciurus carolinensis, Sciurus niger, Sciurus vulgaris, Scleropages formosus, Scolopax minor, Scomber japonicus, Scyliorhinus canicula, Sebastes umbrosus, Setophaga citrina, Setophaga coronata, Setophaga dominica, Setophaga petechia, Setophaga pinus, Sialia sialis, Sigmodon hispidus, Sitta carolinensis, Sorex araneus, Sparus aurata, Spatula clypeata, Spea bombifrons, Sphaeramia orbicularis, Spheniscus humboldti, Spinus tristis, Spirinchus thaleichthys, Spizella passerina, Spizella pusilla, Spizelloides arborea, Sterna hirundo, Streptopelia turtur, Strigops habroptilus, Strix aluco, Struthio camelus, Sturnus vulgaris, Suncus etruscus, Sus scrofa, Sylvia atricapilla, Sylvia borin, Sylvilagus floridanus, Syngnathus acus, Tachycineta bicolor, Tachyglossus aculeatus, Taeniopygia guttata, Takifugu rubripes, Tamandua tetradactyla, Tamias striatus, Tamiasciurus hudsonicus, Tauraco erythrolophus, Taurulus bubalis, Tautogolabrus adspersus, Thalassophryne amazonica, Thamnophis elegans, Theristicus caerulescens, Thryothorus ludovicianus, Thunnus albacares, Thunnus maccoyii, Toxostoma rufum, Toxotes jaculatrix, Trachurus trachurus, Trichosurus vulpecula, Troglodytes aedon, Trogon surrucura, Turdus migratorius, Tursiops truncatus, Unknown, Vespertilio murinus, Vicugna pacos, Vidua chalybeata, Vipera latastei, Vireo griseus, Vireo olivaceus, Xenentodon cancila, Zalophus californianus, Zenaida macroura, Zeus faber, Zonotrichia albicollis | ||
| specimenType | Type of biological material sample taken from a biological entity for research purposes | True | STRING_LIST | ManifestColumn | blood, brain, buffy coat, cell line, cells, nervous system, organoid, plasma, saliva, serum, skin, stool, tissue, urine, Not applicable, Not collected, Not specified, Other, Unknown | ||
| studyKey | The short acronym for a study name in a URL-friendly format (ex. LLFS_Metabolomics OR ELPSCRNA) | True | STRING | Sage Bionetworks | ManifestColumn | ||
| targetGene | Targeted gene or locus name for marker gene studies. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | True | STRING | ManifestColumn | |||
| technologyPlatformVersion | The specific version (application, manufacturer, model, lab, etc.) of a technology that is used to carry out a laboratory or computational experiment. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | True | STRING | ManifestColumn | |||
| Filename | False | STRING | |||||
| metadataType | For files of dataSubtype: metadata, a description of the type of metadata in the file | False | STRING | Sage Bionetworks | ManifestColumn | individual,biospecimen,assay,supplementary files,Not Assigned | |
| project | The ELITE project short name associated with the tool | True | STRING | Sage Bionetworks | ILO BU, ILO TGEN, LC, LG, LLFS, NECS APOE, Not assigned | ||
| organ | Indicate the organ the specimen is from. An organ is a unique macroscopic (gross) anatomic structure that performs specific functions. It is composed of various tissues. | True | STRING | sage.annotations-experimentalData.organ-0.0.4 | ManifestColumn | blood, bone marrow, brain, breast, Bursa Of Fabricius, cerebrospinal fluid, colon, kidney, large intestine, liver, lung, lymph node, mammary gland, nerves, nose, ovary, pancreas, prostate, skin, spleen, Not collected, Not specified, Not applicable, Other, Unknown, plasma, gonadal fat, inguinal fat, gastrocnemius muscle | |
| tissue | Indicate the tissue the specimen is from. A tissue is a multicellular anatomical structure that consists of many cells of one or a few types arranged in an extracellular matrix. | True | STRING_LIST | sage.annotations-experimentalData.tissue-0.0.11 | ManifestColumn | amygdala, amygdaloid complex, anterior cingulate cortex, angular gyrus, blood, bone marrow, Buccal Mucosa, Buffy Coat, caudate nucleus, cecum derived fecal material, cerebellar cortex, cerebellum, cerebral cortex, cortical plate, dorsal anterior cingulate cortex, dorsal pallium, Dorsal Root Ganglion, dorsolateral prefrontal cortex, dorsomedial prefrontal cortex, embryonic tissue, entorhinal cortex, fecal material, forebrain, frontal cortex, frontal lobe, frontal pole, fusiform gyrus, hippocampus, head of caudate nucleus, inferior frontal gyrus, inferior temporal cortex, inferior temporal gyrus, inferolateral temporal cortex, insula, insular cortex, lateral entorhinal cortex, left cerebral hemisphere, liver, mammillary body, medial dorsal nucleus of thalamus, medial entorhinal cortex, medial frontal cortex, medial ganglionic eminence, medial orbital frontal cortex, medial prefrontal cortex, meninges, midbrain, middle frontal gyrus, middle temporal gyrus, nerve tissue, Not Applicable, nucleus accumbens, occipital lobe, occipital visual cortex, olfactory neuroepithelium, orbitofrontal cortex, parahippocampal gyrus, parietal cortex, parietal lobe, plasma, posterior cingulate cortex, posteroinferior parietal cortex, posterior inferior parietal cortex, posterior superior temporal cortex, precentral gyrus, prefrontal cortex, primary auditory cortex, primary motor cortex, primary somatosensory cortex, primary tumor, primary visual cortex, putamen, right cerebral hemisphere, serum, splenocyte, striatum, subgenual anterior cingulate cortex, subgenual cingulate cortex, superior parietal lobe, superior temporal gyrus, temporal cortex, temporal lobe, temporal pole, thalamus, unspecified, ventricular zone, ventrolateral prefrontal cortex, VZ/SVZ, whole brain, gonadal fat, inguinal fat, kidney, plasma, liver, gastrocnemius muscle | |
| familyStudyParticipant | Indicates whether or not a file has data from a human participant involved in a family study (ex. LLFS) | False | STRING | sage.annotations-demographics.ethnicityfamilyStudyParticipant-0.0.2 | ManifestColumn | Yes, No, Not Assigned | |
| assay | The analysis or technology used to generate the data in this file | True | STRING_LIST | sage.annotations-experimentalData.assay-0.0.26 | ManifestColumn | 10x multiome, 16SrRNAseq, active avoidance learning behavior, anxiety-related behavior, ATACSeq, atomicForceMicroscopy, autoradiography, Baker Lipidomics, Biocrates Bile Acids, Biocrates p180, Biocrates Q500, bisulfiteSeq, Blood Chemistry Measurement, brightfieldMicroscopy, cellViabilityAssay, ChIPSeq, CITESeq, contextual conditioning behavior, CUT&Tag, DIA, DNA optical mapping, electrochemiluminescence, elevated plus maze test, elevated T maze apparatus method, ELISA, errBisulfiteSeq, exomeSeq, FIA-MSMS, FitBark, frailty assessment, Genotyping, HI-C, HiChIPseq, high content screen, HPLC, HPLC-MSMS, Immunocytochemistry, immunofluorescence, immunohistochemistry, in vivo bioluminescence, ISOSeq, jumpingLibrary, kinesthetic behavior, label free mass spectrometry, Laser Speckle Imaging, LC-MS, LC-MSMS, LC-SRM, Leiden Oxylipins, lentiMPRA, LFP, liquid chromatography-electrochemical detection, lncrnaSeq, locomotor activation behavior, long-read rnaSeq, LTP, MDMS-SL, memory behavior, Metabolon, methylationArray, MIB/MS, microRNAcounts, mirnaArray, mirnaSeq, MRI, mRNAcounts, MudPIT, m6A-rnaSeq, nextGenerationTargetedSequencing, Nightingale NMR, NOMe-Seq, novelty response behavior, open field test, oxBS-Seq, pharmacodynamics, pharmacokinetics, photograph, polymeraseChainReaction, Positron Emission Tomography, proximity extension assay, questionnaire, Rader Lipidomics, Real Time PCR, Ribo-Seq, rotarod performance test, rnaArray, rnaSeq, RPPA, sandwich ELISA, Sanger sequencing, scale, scATACSeq, scCGIseq, scirnaSeq, scrnaSeq, scwholeGenomeSeq, SiMoA, snpArray, snATACSeq, snrnaSeq, spontaneous alternation, STARRSeq, TMT quantitation, tractionForceMicroscopy, UPLC-MSMS, UPLC-ESI-QTOF-MS, UC Davis GCTOF, UCSD Untargeted Metabolomics, Vernier Caliper, von Frey test, westernBlot, wheel running, whole-cell patch clamp, wholeGenomeSeq, Wishart Catecholamines, Wishart High Value Metabolites, Zeno Electronic Walkway, Not collected, Not specified, Not applicable, Other, Unknown | |
| platformLocation | The name of the laboratory, facility, vendor, company, or location where the data generation platform was located, provided by the data contributor. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | True | STRING | sage.annotations-experimentalData.platformLocation-0.0.2 | ManifestColumn | ||
| isMultiSpecimen | Boolean flag indicating whether or not a file has data for multiple specimens | True | STRING | Sage Bionetworks | ManifestColumn | true,false,Not assigned | |
| libraryPrep | The general strategy by which the library was prepared. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | True | STRING | sage.annotations-ngs.libraryPrep-0.0.13 | ManifestColumn | amplicon, cellHashing, Chromium Single Cell 3', DNALibraryConstruction, EndItDNAEndRepairKit, KapaHyperPrep, lncRNAenrichment, methylSeq, miRNAenrichment, multiome, MULTIseq, PCRfree, polyAselection, proximity ligation, rRNAdepletion, snIsoSeq, SPLITseq, STARRSeq, SureCell, totalRNA, Unknown, Not collected, Not applicable, Not specified |