assay metagenomics annotation template
Template for file-based Metagenomics annotations [Download]
| Attribute | Description | Required | columnType | DependsOn | Source | Parent | Valid Values |
|---|---|---|---|---|---|---|---|
| ModelSystemType | Type of model system | False | BOOLEAN | Sage Bionetworks | ManifestColumn | animal, cerebral organoid, immortalized cell line, iPSC, organoid, primary cell culture, Not assigned | |
| isModelSystem | Boolean flag indicating whether or not a file has data from a model system | True | BOOLEAN | Sage Bionetworks | ManifestColumn | True, False, Not assigned | |
| DNAextraction | DNA extraction kit method. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | True | STRING | ManifestColumn | |||
| adapters | Adapters provide priming sequences for both amplification and sequencing of the sample-library fragments. Both adapters should be reported; in uppercase letters. Example - 'AATGATACGGCGACCACCGAGATCTACACGCT; CAAGCAGAAGACGGCATACGAGAT'Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | True | STRING | ManifestColumn | |||
| analysisType | Type of analysis | False | STRING | Sage Bionetworks | ManifestColumn | ANOVA, batch effect correction, clustering, data normalization, de-novo assembly, dose response study, enrichment analysis, genome-wide association, mendelian randomization analysis, network analysis, polygenic risk scores, Not assigned, expression analysis, genetic variation analysis, image analysis, pathway analysis, phylogenetic analysis, protein function analysis, sequence analysis, spectral analysis, structure analysis, text mining, transmembrane protein analysis, Other, Not applicable | |
| assemblyName | Name/version of the assembly provided by the submitter used in the genome browsers and the community. Example - 'HuRef, JCVI_ISG_3_1.0'Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | True | STRING | ManifestColumn | |||
| assemblyQual | Assembly quality. The assembly quality category is based on sets of criteria outlined for each assembly quality category.High Quality- Multiple fragments where gaps span repetitive regions. Presence of the 23S, 16S and 5S rRNA genes and at least 18 tRNAs.Medium Quality- Many fragments with little to no review of assembly other than reporting of standard assembly statistics.Low Quality- Many fragments with little to no review of assembly other than reporting of standard assembly statistics. Assembly statistics include, but are not limited to, total assembly size, number of contigs, contig N50/L50, and maximum contig length. Example values - high-quality genome, medium-quality genome, low-quality genome | True | STRING | ManifestColumn | |||
| assemblySoftware | Tool(s) used for assembly, including version number and parameters. Example - 'metaSPAdes;3.11.0; kmer set 21,33,55,77,99,121, default parameters otherwise'. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | True | STRING | ManifestColumn | |||
| associatedResource | Relevant electronic resources. A related resource that is referenced, cited, or otherwise associated to the sequence. Example - 'http-//www.earthmicrobiome.org/'Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | True | STRING | ManifestColumn | |||
| commonName | The biological species common name the individual belongs to (ex. "Horned Lark"). note- As a default, the valid scientific name for the species should be indicated. | True | STRING | ManifestColumn | abyssinian ground hornbill, acorn worm, adriatic sturgeon, aeolian wall lizard, african grass rat, alpaca, alvarez's mastiff bat, amazonian toadfish, american alligator, american beaver, american black bear, american crow, american flamingo, american goldfinch, american mink, american red squirrel, american robin, american shad, american tree sparrow, american woodcock, anna's hummingbird, antarctic jonasfish, antarctic lanternfish, antarctic spiny plunderfish, Aplidium pallidum, argentine brown bat, aristotle's catfish, asian arowana, asian elephant, atlantic bluefin tuna, atlantic cod, atlantic hagfish, atlantic halibut, atlantic horse mackerel, atlantic mackerel, atlantic stingray, atlantic white-sided dolphin, audouin's gull, baked bean sea squirt, ballan wrasse, banded archerfish, banded killifish, bank vole, barbel, barn swallow, barnacle goose, barred grass snake, basking shark, bearded vulture, big brown bat, black goby, black mastiff bat, black rat, black rhinoceros, black-headed gull, black-legged kittiwake, black-necked grebe, blainville's beaked whale, blasius's horseshoe bat, blonde ray, blue catfish, blue grosbeak, blue jay, blue whale, blue whiting, blue-and-yellow macaw, blunt-snouted clingfish, boa dragonfish, bocage's wall lizard, boeseman's rainbowfish, bolin's lanternfish, bolivian squirrel monkey, bolson tortoise, bowhead whale, brauer's lanternfish, brown long-eared bat, brown rat, brown thrasher, brown trout, brown-headed cowbird, budgerigar, burrunan dolphin, bushy-tailed woodrat, butterfly blenny, cairo spiny mouse, california sea lion, canada goose, canada lynx, cape hairy bat, capybara, carolina chickadee, carolina wren, caspian gull, caspian tern, catalonian wall lizard, cattle, cave nectar bat, cedar waxwing, channel bull blenny, chimpanzee, chinese hamster, chinese pangolin, chipping sparrow, chiriquinan serotine, chub mackerel, cinnamon teal, climbing perch, clouded leopard, coastal tailed frog, common big-eared bat, common blackbird, common bottlenose dolphin, common bream, common brushtail possum, common buzzard, common chaffinch, common crane, common cuckoo, common dab, common dace, common degu, common dolphin, common dragonet, common eider, common european adder, common frog, common goby, common goldeneye, common grackle, common gull, common kestrel, common marmoset, common midwife toad, common minke whale, common moorhen, common myna, common ostrich, common pipistrelle, common pochard, common redshank, common ringed plover, common roach, common rudd, common shelduck, common shrew, common sole, common starfish, common starling, common swift, common tern, common toad, common wall lizard, common whitefish, common wood pigeon, common yellowthroat, convict blenny, Cooper's hawk, copperband butterflyfish, corbin's sand eel, corkwing wrasse, cory's shearwater, cotton mouse, coyote, coypu, crab-eating macaque, crested bigscale, cretan wall lizard, crucian carp, cuckoo wrasse, cunner, curacao myotis, cuvier's beaked whale, dalmatian pelican, dalmatian wall lizard, damaraland mole-rat, daubenton's bat, davis's round-eared bat, delta smelt, denticle herring, diamondback terrapin, Didemnum pseudofulgens, Diplosoma listerianum, double-crested cormorant, downy woodpecker, eastern bluebird, eastern chipmunk, eastern cottontail, eastern gray squirrel, eastern happy, eastern mole, eastern mosquitofish, eastern narrow-mouthed toad, eastern phoebe, eastern towhee, eastern woodrat, echo parakeet, egyptian fruit bat, egyptian goose, electric eel, electron subantarctic lanternfish, epaulette shark, erhard's wall lizard, etruscan shrew, eurasian beaver, eurasian blackcap, eurasian blue tit, eurasian collared dove, eurasian coot, eurasian curlew, eurasian minnow, eurasian otter, eurasian oystercatcher, eurasian red squirrel, eurasian sparrowhawk, eurasian spoonbill, eurasian teal, european badger, european chub, european conger, european eel, european fire-bellied toad, european flounder, european golden plover, european ground squirrel, european hedgehog, european herring gull, european lancelet, european leaf-toed gecko, european mole, european nightjar, european pied flycatcher, european pilchard, european pine marten, european plaice, european pond turtle, european rabbit, european river lamprey, european robin, european sea squirt, european shag, european smelt, european snow vole, european sprat, european turtle dove, european water vole, false killer whale, field sparrow, fifteen-spined stickleback, fin whale, fivebeard rockling, flier cichlid, florida worm lizard, football sea squirt, fox squirrel, fraser's lanternfish, french guiana freshwater stingray, freshwater garfish, gaboon caecilian, gadwall, galili blind mole-rat, garden warbler, gelatinous eelpout, geoffroy's bat, geoffroy's horseshoe bat, giant-fin mudskipper, gilthead seabream, glaucous gull, glaucous-winged gull, golden eagle, golden hamster, golden spiny mouse, goode's thornscrub tortoise, gray catbird, gray short-tailed opossum, gray whale, gray wolf, great black-backed gull, great bustard, great cormorant, great crested grebe, great evening bat, great fruit-eating bat, great horned owl, great potoo, great white shark, greater argentine, greater horseshoe bat, greater mouse-eared bat, greater pipefish, greater scaup, greater tube-nosed bat, greater white-fronted goose, green sea turtle, green-winged teal, grey crowned crane, grey gurnard, grey long-eared bat, grey seal, greylag goose, groundhog, guam kingfisher, gudgeon, guinea pig, gyrfalcon, hairy woodpecker, hairy-legged myotis, hairy-nosed bat, harbour porpoise, harpy eagle, harvest mouse, hawaiian crow, hawksbill sea turtle, hazel dormouse, heller's broad-nosed bat, highfin lizardfish, hildebrandt's horseshoe bat, hispid cotton rat, honeycomb rockfish, hooded warbler, horned lark, horse, hourglass treefrog, house finch, house mouse, house sparrow, house wren, human, humboldt penguin, ibiza wall lizard, iceland gull, indian glassy fish, indigo bunting, indo-pacific tarpon, intermediate fruit-eating bat, intermediate roundleaf bat, italian wall lizard, jamaican fruit bat, japanese pufferfish, jewelled blenny, john dory, kagu, kakapo, kauai elepaio, kemp's ridley sea turtle, killdeer, killer whale, kuhl's pipistrelle, lance-tailed manakin, lanner falcon, lanternfish, large-eye snaggletooth, largescale foureyes, lataste's viper, least weasel, leatherback sea turtle, leisler's bat, lemon sole, lesser black-backed gull, lesser egyptian jerboa, lesser horseshoe bat, lesser kestrel, lesser rhea, lesser sand eel, lesser weever, lesser white-fronted goose, light-bulb sea squirt, linnaeus's two-toed sloth, little brown bat, little owl, little yellow-shouldered bat, live sharksucker, loggerhead sea turtle, long-finned pilot whale, long-tailed chinchilla, long-tailed duck, long-tailed tit, longfin smelt, longspined bullhead, lowland paca, lumpfish, maguari stork, mallard, mallorcan midwife toad, maltese wall lizard, marbled rockcod, masked duck, mauritius kestrel, meadow viper, meadow vole, merriam's long-tongued bat, mesoamerican mustached bat, milkfish, milos viper, minispotted lanternsfish, mongolian gerbil, monito del monte, mourning dove, Multi-species, muskrat, mute swan, naked mole-rat, nathusius's pipistrelle, natterer's bat, nelson's sparrow, new caledonian crow, nine-banded armadillo, ninespine stickleback, north american deermouse, north american porcupine, north atlantic right whale, northern bat, northern bottlenose whale, northern cardinal, northern carmine bee-eater, northern crested newt, northern goshawk, northern lapwing, northern mockingbird, northern mole vole, northern pike, northern pintail, northern short-tailed shrew, northern shoveler, norwegian topknot, Not applicable, Not collected, Not provided, Not specified, olive baboon, olive python, orange-tipped sea squirt, orbiculate cardinalfish, Other, painted frog, pale spear-nosed bat, pallas's mastiff bat, palmate newt, parti-coloured bat, pearleye, pencil smelt, peregrine falcon, philippine flying lemur, pine warbler, pinecone soldierfish, pink pigeon, pink-footed goose, plains spadefoot toad, platypus, plumbeous ibis, pollack, Polycarpa mamillaris, Polycarpa scuba, pool frog, pouting, proboscis bat, Protomyctophum andriashevi, Protomyctophum parallelum, pygmy fruit-eating bat, rainbow smelt, rakery beaconlamp, razorbill, red bandfish, red deer, red devil cichlid, red fox, red gurnard, red junglefowl, red kite, red porgy, red-bellied piranha, red-bellied woodpecker, red-billed tropicbird, red-breasted merganser, red-crested pochard, red-crested turaco, red-eyed vireo, red-fronted tinkerbird, red-legged seriema, red-shouldered hawk, red-tailed hawk, red-throated loon, reedfish, reeves's muntjac, rhesus macaque, rhombic lanternfish, rifleman, riggenbach's reed frog, ring-billed gull, ring-necked pheasant, ring-tailed lemur, risso's dolphin, rock gunnel, rock pigeon, rough lanternfish, royal ground snake, ruby-crowned kinglet, ruby-throated hummingbird, ruff, ruffed grouse, rufous frog, saker falcon, saltmarsh sparrow, sand lizard, sandhill crane, savannah sparrow, schreibers's bent-winged bat, sea lamprey, sei whale, seychelles magpie-robin, shanny, short-beaked echidna, siberian chipmunk, silver hatchetfish, silvereye, skyros wall lizard, small-eyed ray, small-spotted catshark, smalltooth sawfish, smew, smooth newt, snow crab, solenette, song sparrow, soprano pipistrelle, south island takahe, southern bluefin tuna, southern corroboree frog, southern giant pouched rat, southern tamandua, sowell's short-tailed bat, sowerby's beaked whale, speckled mousebird, sperm whale, spotted ray, spotted sandpiper, spotted scat, spotty, stalked sea squirt, star-nosed mole, starry smooth-hound, sterlet, stoat, Stomias gracilis, stone loach, stoplight loosejaw, striped aplochiton, striped catfish, striped dolphin, striped dwarf hamster, sugar glider, sunda slow loris, surucua trogon, swainson's thrush, swamp sparrow, swift parrot, taiga bean goose, tammar wallaby, tawny frogmouth, tawny owl, Telmatherina bonti, thickback sole, thicklip grey mullet, thorny skate, three-bearded rockling, three-spined stickleback, tiny cayenne caecilian, trahira, transcaucasian mole vole, tree swallow, true's beaked whale, trumpet flake-ascidian, tub gurnard, tufted duck, tufted titmouse, tundra swan, tunicate, turbot, two-lined caecilian, two-spotted clingfish, tyrrhenian wall lizard, Unknown, vaquita, vaucher's wall lizard, village indigobird, viviparous lizard, warty frogfish, water rail, western barbastelle, western barn owl, western capercaillie, western gull, western jackdaw, western terrestrial garter snake, whiskered bat, whiskered treeswift, white-beaked dolphin, white-breasted nuthatch, white-eyed vireo, white-faced whistling duck, white-footed mouse, white-tailed deer, white-tailed eagle, white-throated dipper, white-throated sparrow, whooper swan, whooping crane, wild boar, wild turkey, wood duck, wood frog, wood mouse, wood thrush, worm pipefish, yellow warbler, yellow-bellied toad, yellow-breasted chat, yellow-legged gull, yellow-necked mouse, yellow-rumped warbler, yellow-spotted rock hyrax, yellow-throated sandgrouse, yellow-throated warbler, yellowfin tuna, zebra finch, zebrafish, zig-zag eel | ||
| consortium | The name of the consortium | True | STRING | Sage Bionetworks | ManifestColumn | ELITE, ELITE CDCP, Not assigned | |
| dataFile | Name of additional file(s) accompanying the data. The file(s) provide, for example, the name of any raw files generated by the instrument, generated reports from a vendor, an Rscript, or an instructions document. The files can be instrument raw files, converted peak lists such as mzML, MGF, or result files like mzIdentML. The files can be additional documentation submitted alongside the data needed for reuse and sharing purposes. Provide the file names of any additional files submitted alongside the data (ex., an ADAT file). Multiple file names can be separated by (;)Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | True | STRING | ManifestColumn | |||
| dataSubtype | Further qualification of dataType, which may be used to indicate the state of processing of the data, aggregation of the data, or presence of metadata | True | STRING | Sage Bionetworks | ManifestColumn | raw,processed,results,normalized,metadata, Not assigned | |
| dataType | The category or format of data generated or collected in an experiment, describing the kind of information the dataset contains (for example, genomics, imaging, proteomics, or behavioral data). | True | STRING_LIST | Sage Bionetworks | ManifestColumn | clinical,drugScreen,electrophysiology,epigenetics,geneExpression,genomeAssembly,genomicVariants,imaging,lipidomics,metabolomics,metagenomics,Not applicable,Not collected,Not specified,Other,phenotype,proteomics,Unknown,wearableData | |
| databaseLibrary | The name(s) of the associated database library. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | True | STRING | ManifestColumn | |||
| databaseName | The name of the search database (nr, SwissProt or est_human, and/or mass spectral library). Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | True | STRING | ManifestColumn | |||
| databaseSource | The name of the organization, project, or laboratory from where the database is obtained (UniProt, NCBI, EBI, other). | True | STRING | ManifestColumn | |||
| databaseVersion | The version of the database. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | True | STRING | ManifestColumn | |||
| databaseWeblink | An internet address that may provide details of a database or software search, as well as for labs that generate their own search method (web link). Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | True | STRING | ManifestColumn | |||
| experimentType | The type of experiment used. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | True | STRING | ManifestColumn | |||
| experimentalFactor | Variable aspects of an experiment design that can be used to describe an experiment or set of experiments in an increasingly detailed manner.This field accepts ontology terms from Experimental Factor Ontology (EFO) and/or Ontology for Biomedical Investigations (OBI). Example - 'time series design [EFO-0001779]'Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | True | STRING | ManifestColumn | |||
| fileFormat | Defined format of the data file, typically corresponding to extension, but sometimes indicating more general group of files produced by the same tool or software | True | STRING | Sage Bionetworks | ManifestColumn | FASTQ, FASTA, SAM, BAM, CRAM, VCF, BCF, GTF, GFF, GFF3, BED, BigBed, WIG, BigWig, CSV, TSV, MTX, H5AD, LOOM, RDS,PED, MAP, BED_PLINK, TPED, TFAM, BEDGRAPH, NARROWPEAK, BROADPEAK, TAGALIGN, OME-TIFF, ND2, CZI, LSM, H5, HDF5, PARQUET, PDB, MMCIF, JSON, YAML, XML, TXT, XLSX, CSV, Not assigned | |
| instrumentModel | The model of the instrument used. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | True | STRING | ManifestColumn | |||
| libLayout | Library layout. Specify whether to expect single, paired, or other configurations of reads. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | True | STRING | ManifestColumn | |||
| libReadsSeqd | Library reads sequenced. Total number of clones sequenced from the library. Example - '20'Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | True | INTEGER | ManifestColumn | |||
| libSize | Library size. Total number of clones in the library prepared for the project. Example - '50'Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | True | INTEGER | ManifestColumn | |||
| libVector | Library vector. Cloning vector type(s) used in the construction of libraries. Example - 'Bacteriophage P1'Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | True | STRING | ManifestColumn | |||
| measurementTechnique | The name of the measurement technique describing the assay method. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | True | STRING | ManifestColumn | Bisulfite sequencing,Clinical data,Genome-wide association study,High-performance liquid chromatography tandem mass spectrometry,Liquid chromatography mass spectrometry,Liquid chromatography tandem mass spectrometry,Mass spectrometry,Metabolomics,MetaX-processed metabolomics data,Proximity extension assay,RNA sequencing,Single-cell RNA sequencing,Shotgun metagenomic sequencing,Single nucleotide polymorphism array,Tandem Mass Tag proteomics,Whole-genome sequencing,Unknown,Other,Not collected,Not applicable,Not specified | ||
| mid | Multiplex identifiers. Molecular barcodes, called Multiplex Identifiers (MIDs), are used to tag unique samples in a sequencing run specifically. Sequence should be reported in uppercase letters. Example - 'GTGAATAT'Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | True | STRING | ManifestColumn | |||
| nucleAcidExt | Nucleic acid extraction. A link to a literature reference, electronic resource or a standard operating procedure (SOP), that describes the material separation to recover the nucleic acid fraction from a sample. (example, https-//mobio.com/media/wysiwyg/pdfs/protocols/12888.pdf). Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | True | STRING | ManifestColumn | |||
| numberContig | Number of contigs. Total number of contigs in the cleaned/submitted assembly that comprise a given genome, SAG, MAG, or UViG. Example - '40'Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | False | INTEGER | ManifestColumn | |||
| resourceType | The type of resource being stored and annotated | True | STRING | Sage Bionetworks | ManifestColumn | experimentalData,metadata,tool,analysis,computationalNotebook,softwareTool,Not assigned | |
| samplePrepProtocol | An internet address that may provide more details of the protocol information (web link). Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | True | STRING | ManifestColumn | |||
| seqMethod | Sequencing method. Sequencing method used; Example - 'Sanger, pyrosequencing, ABI-solid'. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | True | STRING | ManifestColumn | |||
| seqPlatform | Sequencing platform information. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | True | STRING | ManifestColumn | |||
| sop | Relevant standard operating procedures. Standard operating procedures used in the assembly and/or annotation of genomes, metagenomes, or environmental sequences. Example - 'http-//press.igsb.anl.gov/earthmicrobiome/protocols-and-standards/its/)'Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | True | STRING | ManifestColumn | |||
| sourceMatID | Source material identifiers. A unique identifier assigned to a material sample (as defined by http-//rs.tdwg.org/dwc/terms/materialSampleID and as opposed to a particular digital record of a material sample) used for extracting nucleic acids, and subsequent sequencing.The identifier can refer to the original material collected or any derived sub-samples. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | True | STRING | ManifestColumn | |||
| speciesGroup | The taxonomic ranking including both species and subspecies the individual belongs to. | True | STRING | ManifestColumn | Amphibian,Bird,Fish,Invertebrate,Mammal,Not applicable,Not collected,Not specified,Reptile,Unknown | ||
| speciesName | The scientific name of the species (typically a taxonomic group, ex. "Eremophila alpestris) the individual belongs to.""" | True | STRING | ManifestColumn | Abramis brama, Acanthisitta chloris, Accipiter cooperii, Accipiter gentilis, Accipiter nisus, Acipenser naccarii, Acipenser ruthenus, Acomys cahirinus, Acomys russatus, Acridotheres tristis, Actitis macularius, Aegithalos caudatus, Aix sponsa, Alca torda, Alligator mississippiensis, Alopochen aegyptiaca, Alosa sapidissima, Alytes muletensis, Alytes obstetricans, Amblyraja radiata, Ammodramus caudacutus, Ammodytes marinus, Ammospiza nelsoni, Amphilophus labiatus, Anabas testudineus, Anableps anableps, Anas acuta, Anas carolinensis, Anas crecca, Anas platyrhynchos, Anguilla anguilla, Anser albifrons, Anser anser, Anser brachyrhynchus, Anser erythropus, Anser fabalis, Antennarius maculatus, Antigone canadensis, Aplidium pallidum, Aplidium turbinatum, Aplochiton taeniatus, Apodemus flavicollis, Apodemus sylvaticus, Apus apus, Aquila chrysaetos, Ara ararauna, Archilochus colubris, Archocentrus centrarchus, Argentina silus, Argyropelecus olfersii, Artibeus intermedius, Artibeus jamaicensis, Artibeus lituratus, Arvicanthis niloticus, Arvicola amphibius, Ascaphus truei, Ascidia mentula, Ascidiella aspersa, Astatotilapia calliptera, Asterias rubens, Athene noctua, Aythya ferina, Aythya fuligula, Aythya marila, Baeolophus bicolor, Balaena mysticetus, Balaenoptera acutorostrata, Balaenoptera borealis, Balaenoptera musculus, Balaenoptera physalus, Balearica regulorum, Barbastella barbastellus, Barbatula barbatula, Barbus barbus, Bathysaurus mollis, Benthalbella elongata, Blarina brevicauda, Blennius ocellaris, Bombina bombina, Bombina variegata, Bombycilla cedrorum, Bonasa umbellus, Borostomias antarcticus, Bos taurus, Branchiostoma lanceolatum, Branta canadensis, Branta leucopsis, Bubo virginianus, Bucephala clangula, Bucorvus abyssinicus, Bufo bufo, Buglossidium luteum, Buteo buteo, Buteo jamaicensis, Buteo lineatus, Calidris pugnax, Callionymus lyra, Callithrix jacchus, Calonectris borealis, Calypte anna, Canis latrans, Canis lupus, Caprimulgus europaeus, Carassius carassius, Carcharodon carcharias, Cardinalis cardinalis, Caretta caretta, Cariama cristata, Carollia sowelli, Castor canadensis, Castor fiber, Catharus ustulatus, Cavia porcellus, Cepola macrophthalma, Cervus elaphus, Cetorhinus maximus, Chanos chanos, Charadrius hiaticula, Charadrius vociferus, Chasiempis sclateri, Chelidonichthys cuculus, Chelidonichthys lucerna, Chelmon rostratus, Chelon labrosus, Chelonia mydas, Chinchilla lanigera, Chionoecetes opilio, Chionomys nivalis, Chiroxiphia lanceolata, Choloepus didactylus, Chroicocephalus ridibundus, Ciconia maguari, Ciliata mustela, Cinclus cinclus, Clangula hyemalis, Clavelina lepadiformis, Colius striatus, Coloeus monedula, Columba livia, Columba palumbus, Condylura cristata, Conger conger, Copsychus sechellarum, Coregonus lavaretus, Corella eumyota, Corvus brachyrhynchos, Corvus hawaiiensis, Corvus moneduloides, Cottoperca gobio, Cricetomys ansorgei, Cricetulus barabensis, Cricetulus griseus, Cryptomys damarensis, Cuculus canorus, Cuniculus paca, Cyanistes caeruleus, Cyanocitta cristata, Cyclopterus lumpus, Cygnus columbianus, Cygnus cygnus, Cygnus olor, Cynocephalus volans, Danio rerio, Dasypus novemcinctus, Delphinus delphis, Dendrocygna viduata, Dendrodoa grossularia, Dendropsophus ebraccatus, Denticeps clupeoides, Dermanura phaeotis, Dermochelys coriacea, Diazona violacea, Diceros bicornis, Didemnum pseudofulgens, Diplecogaster bimaculata, Diplosoma listerianum, Discoglossus pictus, Dromiciops gliroides, Dryobates pubescens, Dumetella carolinensis, Echeneis naucrates, Echiichthys vipera, Electrona antarctica, Electrona carlsbergi, Electrona subaspera, Electrophorus electricus, Elephas maximus, Ellobius lutescens, Ellobius talpinus, Emys orbicularis, Eonycteris spelaea, Eptesicus chiriquinus, Eptesicus furinalis, Eptesicus fuscus, Eptesicus nilssonii, Equus caballus, Eremophila alpestris, Erethizon dorsatum, Eretmochelys imbricata, Erinaceus europaeus, Erithacus rubecula, Erpetoichthys calabaricus, Erythrolamprus reginae, Eschrichtius robustus, Esox lucius, Eubalaena glacialis, Euleptes europaea, Eutrigla gurnardus, Falco biarmicus, Falco cherrug, Falco naumanni, Falco peregrinus, Falco punctatus, Falco rusticolus, Falco tinnunculus, Ficedula hypoleuca, Fringilla coelebs, Fukomys damarensis, Fulica atra, Fundulus diaphanus, Gadus morhua, Gaidropsarus vulgaris, Gallinula chloropus, Gallus gallus, Gambusia holbrooki, Gardnerycteris keenani, Gasterosteus aculeatus, Gastrophryne carolinensis, Gavia stellata, Geothlypis trichas, Geotrypetes seraphini, Globicephala melas, Glossophaga mutica, Gobio gobio, Gobius niger, Gopherus evgoodei, Gopherus flavomarginatus, Gouania willdenowi, Grampus griseus, Grus americana, Grus grus, Gulosus aristotelis, Gymnoscopelus braueri, Gymnoscopelus fraseri, Gymnoscopelus microlampas, Gypaetus barbatus, Haematopus ostralegus, Haemorhous mexicanus, Haliaeetus albicilla, Halichoerus grypus, Harpagifer antarcticus, Harpia harpyja, Hemiprocne comata, Hemiscyllium ocellatum, Heterocephalus glaber, Heterohyrax brucei, Hippoglossus hippoglossus, Hipposideros larvatus, Hirundo rustica, Homo sapiens, Hoplias malabaricus, Hydrochoerus hydrochaeris, Hydroprogne caspia, Hylocichla mustelina, Hypanus sabinus, Hyperolius riggenbachi, Hyperoodon ampullatus, Hyperoplus immaculatus, Hypomesus transpacificus, Ia io, Ichthyaetus audouinii, Icteria virens, Jaculus jaculus, Krefftichthys anderssoni, Labrus bergylta, Labrus mixtus, Lacerta agilis, Lagenorhynchus acutus, Lagenorhynchus albirostris, Lampanyctus macdonaldi, Lampetra fluviatilis, Larus argentatus, Larus cachinnans, Larus canus, Larus delawarensis, Larus fuscus, Larus glaucescens, Larus glaucoides, Larus hyperboreus, Larus marinus, Larus michahellis, Larus occidentalis, Lathamus discolor, Lemur catta, Lepidochelys kempii, Leptodactylus fuscus, Leuciscus leuciscus, Liasis olivaceus, Limanda limanda, Lipophrys pholis, Lissotriton helveticus, Lissotriton vulgaris, Lophostoma evotis, Lutra lutra, Lynx canadensis, Macaca fascicularis, Macaca mulatta, Macropus eugenii, Macrovipera schweizeri, Malaclemys terrapin, Malacosteus niger, Manis pentadactyla, Mareca strepera, Marmota monax, Martes martes, Mastacembelus armatus, Megalops cyprinoides, Melanerpes carolinus, Melanostigma gelatinosum, Melanotaenia boesemani, Meleagris gallopavo, Meles meles, Melopsittacus undulatus, Melospiza georgiana, Melospiza melodia, Mergellus albellus, Mergus serrator, Meriones unguiculatus, Merops nubicus, Mesocricetus auratus, Mesoplodon bidens, Mesoplodon densirostris, Mesoplodon mirus, Microcaecilia unicolor, Microchirus variegatus, Micromesistius poutassou, Micromys minutus, Micronycteris microtis, Microstomus kitt, Microtus pennsylvanicus, Milvus milvus, Mimus polyglottos, Miniopterus schreibersii, Molossus alvarezi, Molossus molossus, Molossus nigricans, Molothrus ater, Monodelphis domestica, Multi-species, Muntiacus reevesi, Murina leucogaster, Mus musculus, Muscardinus avellanarius, Mustela erminea, Mustela nivalis, Mustelus asterias, Myocastor coypus, Myodes glareolus, Myotis daubentonii, Myotis emarginatus, Myotis lucifugus, Myotis myotis, Myotis mystacinus, Myotis nattereri, Myotis nesopolus, Myotis pilosatibialis, Myotis tricolor, Myripristis murdjan, Myxine glutinosa, Nannobrachium achirus, Nannospalax galili, Nansenia antarctica, Natrix helvetica, Neoarius graeffei, Neofelis nebulosa, Neosciurus carolinensis, Neotoma cinerea, Neotoma floridana, Neovison vison, Nerophis lumbriciformis, Nesoenas mayeri, Netta rufina, Nomonyx dominicus, Not applicable, Not collected, Not provided, Not specified, Notolabrus celidotus, Notolepis coatsi, Notothenia rossii, Numenius arquata, Nyctalus leisleri, Nyctibius grandis, Nycticebus coucang, Octodon degus, Odocoileus virginianus, Ondatra zibethicus, Orcinus orca, Ornithorhynchus anatinus, Oryctolagus cuniculus, Osmerus eperlanus, Osmerus mordax, Other, Otis tarda, Pagrus pagrus, Pan troglodytes, Pangasianodon hypophthalmus, Papio anubis, Parambassis ranga, Passer domesticus, Passerculus sandwichensis, Passerina caerulea, Passerina cyanea, Pelecanus crispus, Pelophylax lessonae, Periophthalmus magnuspinnatus, Peromyscus gossypinus, Peromyscus leucopus, Peromyscus maniculatus, Petaurus breviceps, Petromyzon marinus, Phaethon aethereus, Phalacrocorax auritus, Phalacrocorax carbo, Phasianus colchicus, Phocoena phocoena, Phocoena sinus, Phoenicopterus ruber, Pholidichthys leucotaenia, Pholis gunnellus, Phoxinus phoxinus, Phrynorhombus norvegicus, Phyllostomus discolor, Physeter catodon, Picoides villosus, Pipilo erythrophthalmus, Pipistrellus kuhlii, Pipistrellus nathusii, Pipistrellus pipistrellus, Pipistrellus pygmaeus, Platalea leucorodia, Platichthys flesus, Platyrrhinus helleri, Plecotus auritus, Plecotus austriacus, Pleuronectes platessa, Pluvialis apricaria, Podarcis bocagei, Podarcis cretensis, Podarcis erhardii, Podarcis filfolensis, Podarcis gaigeae, Podarcis liolepis, Podarcis melisellensis, Podarcis muralis, Podarcis pityusensis, Podarcis raffonei, Podarcis siculus, Podarcis tiliguerta, Podarcis vaucheri, Podargus strigoides, Podiceps cristatus, Podiceps nigricollis, Poecile carolinensis, Pogoniulus pusillus, Pollachius pollachius, Polycarpa mamillaris, Polycarpa scuba, Pomatoschistus microps, Poromitra crassiceps, Porphyrio hochstetteri, Potamotrygon marinae, Pristis pectinata, Protomyctophum andriashevi, Protomyctophum bolini, Protomyctophum parallelum, Pseudophryne corroboree, Pseudorca crassidens, Psittacula echo, Pterocles gutturalis, Pteronotus mesoamericanus, Pungitius pungitius, Pygocentrus nattereri, Quiscalus quiscula, Raja brachyura, Raja microocellata, Raja montagui, Rallus aquaticus, Rana sylvatica, Rana temporaria, Rattus norvegicus, Rattus rattus, Regulus calendula, Rhea pennata, Rhinatrema bivittatum, Rhineura floridana, Rhinolophus blasii, Rhinolophus clivosus, Rhinolophus ferrumequinum, Rhinolophus hildebrandtii, Rhinolophus hipposideros, Rhynchonycteris naso, Rhynochetos jubatus, Rissa tridactyla, Rousettus aegyptiacus, Rutilus rutilus, Saccoglossus kowalevskii, Saimiri boliviensis, Salarias fasciatus, Salmo trutta, Sardina pilchardus, Sayornis phoebe, Scalopus aquaticus, Scardinius erythrophthalmus, Scatophagus argus, Sciurus carolinensis, Sciurus niger, Sciurus vulgaris, Scleropages formosus, Scolopax minor, Scomber japonicus, Scomber scombrus, Scophthalmus maximus, Scyliorhinus canicula, Sebastes umbrosus, Setophaga citrina, Setophaga coronata, Setophaga dominica, Setophaga petechia, Setophaga pinus, Sialia sialis, Sigmodon hispidus, Silurus aristotelis, Sitta carolinensis, Solea solea, Somateria mollissima, Sorex araneus, Sparus aurata, Spatula clypeata, Spatula cyanoptera, Spea bombifrons, Spermophilus citellus, Sphaeramia orbicularis, Spheniscus humboldti, Spinachia spinachia, Spinus tristis, Spirinchus thaleichthys, Spizella passerina, Spizella pusilla, Spizelloides arborea, Sprattus sprattus, Squalius cephalus, Stenella coeruleoalba, Sterna hirundo, Stomias boa, Stomias gracilis, Streptopelia decaocto, Streptopelia turtur, Strigops habroptilus, Strix aluco, Struthio camelus, Sturnira parvidens, Sturnus vulgaris, Styela clava, Suncus etruscus, Sus scrofa, Sylvia atricapilla, Sylvia borin, Sylvilagus floridanus, Symphodus melops, Syngnathus acus, Tachycineta bicolor, Tachyglossus aculeatus, Tadorna tadorna, Taeniopygia guttata, Takifugu rubripes, Talpa europaea, Tamandua tetradactyla, Tamias sibiricus, Tamias striatus, Tamiasciurus hudsonicus, Tauraco erythrolophus, Taurulus bubalis, Tautogolabrus adspersus, Telmatherina bonti, Tetrao urogallus, Thalassophryne amazonica, Thamnophis elegans, Theristicus caerulescens, Thryothorus ludovicianus, Thunnus albacares, Thunnus maccoyii, Thunnus thynnus, Todiramphus cinnamominus, Toxostoma rufum, Toxotes jaculatrix, Trachurus trachurus, Trichosurus vulpecula, Tringa totanus, Trisopterus luscus, Triturus cristatus, Troglodytes aedon, Trogon surrucura, Turdus merula, Turdus migratorius, Tursiops australis, Tursiops truncatus, Tyto alba, Unknown, Ursus americanus, Vanellus vanellus, Vespertilio murinus, Vicugna pacos, Vidua chalybeata, Vipera berus, Vipera latastei, Vipera ursinii, Vireo griseus, Vireo olivaceus, Vulpes vulpes, Xenentodon cancila, Zalophus californianus, Zenaida macroura, Zeugopterus norvegicus, Zeus faber, Ziphius cavirostris, Zonotrichia albicollis, Zootoca vivipara, Zosterops lateralis | ||
| specimenType | Type of biological material sample taken from a biological entity for research purposes | True | STRING_LIST | ManifestColumn | blood, brain, buffy coat, cell line, cells, nervous system, organoid, plasma, saliva, serum, skin, stool, tissue, urine, Not applicable, Not collected, Not specified, Other, Unknown | ||
| studyKey | The short acronym for a study name in a URL-friendly format (ex. LLFS_Metabolomics OR ELPSCRNA) | True | STRING | Sage Bionetworks | ManifestColumn | ||
| targetGene | Targeted gene or locus name for marker gene studies. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | True | STRING | ManifestColumn | |||
| technologyPlatformVersion | The specific version (application, manufacturer, model, lab, etc.) of a technology that is used to carry out a laboratory or computational experiment. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | True | STRING | ManifestColumn | |||
| Filename | False | STRING | |||||
| metadataType | For files of dataSubtype: metadata, a description of the type of metadata in the file | False | STRING | Sage Bionetworks | ManifestColumn | individual,biospecimen,assay,supplementary files,Not Assigned | |
| project | The ELITE project short name associated with the tool | True | STRING | Sage Bionetworks | ILO BU, ILO TGEN, LC, LG, LLFS, NECS APOE, Not assigned | ||
| organ | Indicate the organ the specimen is from. An organ is a unique macroscopic (gross) anatomic structure that performs specific functions. It is composed of various tissues. | True | STRING | sage.annotations-experimentalData.organ-0.0.4 | ManifestColumn | blood, bone marrow, brain, breast, Bursa Of Fabricius, cerebrospinal fluid, colon, kidney, large intestine, liver, lung, lymph node, mammary gland, nerves, nose, ovary, pancreas, prostate, skin, spleen, Not collected, Not specified, Not applicable, Other, Unknown, plasma, gonadal fat, inguinal fat, gastrocnemius muscle | |
| tissue | Indicate the tissue the specimen is from. A tissue is a multicellular anatomical structure that consists of many cells of one or a few types arranged in an extracellular matrix. | True | STRING_LIST | sage.annotations-experimentalData.tissue-0.0.11 | ManifestColumn | amygdala, amygdaloid complex, anterior cingulate cortex, angular gyrus, blood, bone marrow, Buccal Mucosa, Buffy Coat, caudate nucleus, cecum derived fecal material, cerebellar cortex, cerebellum, cerebral cortex, cortical plate, dorsal anterior cingulate cortex, dorsal pallium, Dorsal Root Ganglion, dorsolateral prefrontal cortex, dorsomedial prefrontal cortex, embryonic tissue, entorhinal cortex, fecal material, forebrain, frontal cortex, frontal lobe, frontal pole, fusiform gyrus, hippocampus, head of caudate nucleus, inferior frontal gyrus, inferior temporal cortex, inferior temporal gyrus, inferolateral temporal cortex, insula, insular cortex, lateral entorhinal cortex, left cerebral hemisphere, liver, mammillary body, medial dorsal nucleus of thalamus, medial entorhinal cortex, medial frontal cortex, medial ganglionic eminence, medial orbital frontal cortex, medial prefrontal cortex, meninges, midbrain, middle frontal gyrus, middle temporal gyrus, nerve tissue, Not Applicable, nucleus accumbens, occipital lobe, occipital visual cortex, olfactory neuroepithelium, orbitofrontal cortex, parahippocampal gyrus, parietal cortex, parietal lobe, plasma, posterior cingulate cortex, posteroinferior parietal cortex, posterior inferior parietal cortex, posterior superior temporal cortex, precentral gyrus, prefrontal cortex, primary auditory cortex, primary motor cortex, primary somatosensory cortex, primary tumor, primary visual cortex, putamen, right cerebral hemisphere, serum, splenocyte, striatum, subgenual anterior cingulate cortex, subgenual cingulate cortex, superior parietal lobe, superior temporal gyrus, temporal cortex, temporal lobe, temporal pole, thalamus, unspecified, ventricular zone, ventrolateral prefrontal cortex, VZ/SVZ, whole brain, gonadal fat, inguinal fat, kidney, plasma, liver, gastrocnemius muscle | |
| familyStudyParticipant | Indicates whether or not a file has data from a human participant involved in a family study (ex. LLFS) | False | STRING | sage.annotations-demographics.ethnicityfamilyStudyParticipant-0.0.2 | ManifestColumn | Yes, No, Not Assigned | |
| assay | The analysis or technology used to generate the data in this file | True | STRING_LIST | sage.annotations-experimentalData.assay-0.0.26 | ManifestColumn | 10x multiome, 16SrRNAseq, active avoidance learning behavior, anxiety-related behavior, ATACSeq, atomicForceMicroscopy, autoradiography, Baker Lipidomics, Biocrates Bile Acids, Biocrates p180, Biocrates Q500, bisulfiteSeq, Blood Chemistry Measurement, brightfieldMicroscopy, cellViabilityAssay, ChIPSeq, CITESeq, contextual conditioning behavior, CUT&Tag, DIA, DNA optical mapping, electrochemiluminescence, elevated plus maze test, elevated T maze apparatus method, ELISA, errBisulfiteSeq, exomeSeq, FIA-MSMS, FitBark, frailty assessment, Genotyping, HI-C, HiChIPseq, high content screen, HPLC, HPLC-MSMS, Immunocytochemistry, immunofluorescence, immunohistochemistry, in vivo bioluminescence, ISOSeq, jumpingLibrary, kinesthetic behavior, label free mass spectrometry, Laser Speckle Imaging, LC-MS, LC-MSMS, LC-SRM, Leiden Oxylipins, lentiMPRA, LFP, liquid chromatography-electrochemical detection, lncrnaSeq, locomotor activation behavior, long-read rnaSeq, LTP, MDMS-SL, memory behavior, Metabolon, methylationArray, MIB/MS, microRNAcounts, mirnaArray, mirnaSeq, MRI, mRNAcounts, MudPIT, m6A-rnaSeq, nextGenerationTargetedSequencing, Nightingale NMR, NOMe-Seq, novelty response behavior, open field test, oxBS-Seq, pharmacodynamics, pharmacokinetics, photograph, polymeraseChainReaction, Positron Emission Tomography, proximity extension assay, questionnaire, Rader Lipidomics, Real Time PCR, Ribo-Seq, rotarod performance test, rnaArray, rnaSeq, RPPA, sandwich ELISA, Sanger sequencing, scale, scATACSeq, scCGIseq, scirnaSeq, scrnaSeq, scwholeGenomeSeq, SiMoA, snpArray, snATACSeq, snrnaSeq, spontaneous alternation, STARRSeq, TMT quantitation, tractionForceMicroscopy, UPLC-MSMS, UPLC-ESI-QTOF-MS, UC Davis GCTOF, UCSD Untargeted Metabolomics, Vernier Caliper, von Frey test, westernBlot, wheel running, whole-cell patch clamp, wholeGenomeSeq, Wishart Catecholamines, Wishart High Value Metabolites, Zeno Electronic Walkway, Not collected, Not specified, Not applicable, Other, Unknown | |
| platformLocation | The name of the laboratory, facility, vendor, company, or location where the data generation platform was located, provided by the data contributor. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | True | STRING | sage.annotations-experimentalData.platformLocation-0.0.2 | ManifestColumn | ||
| isMultiSpecimen | Boolean flag indicating whether or not a file has data for multiple specimens | True | STRING | Sage Bionetworks | ManifestColumn | true,false,Not assigned | |
| libraryPrep | The general strategy by which the library was prepared. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | True | STRING | sage.annotations-ngs.libraryPrep-0.0.13 | ManifestColumn | amplicon, cellHashing, Chromium Single Cell 3', DNALibraryConstruction, EndItDNAEndRepairKit, KapaHyperPrep, lncRNAenrichment, methylSeq, miRNAenrichment, multiome, MULTIseq, PCRfree, polyAselection, proximity ligation, rRNAdepletion, snIsoSeq, SPLITseq, STARRSeq, SureCell, totalRNA, Unknown, Not collected, Not applicable, Not specified |