Skip to main content Link Menu Expand (external link) Document Search Copy Copied

assay metagenomics template

Template for Metagenomics [Download]

Attribute Description Required columnType DependsOn Source Parent Valid Values
DNAextraction DNA extraction kit method. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified True STRING ManifestColumn
adapters Adapters provide priming sequences for both amplification and sequencing of the sample-library fragments. Both adapters should be reported; in uppercase letters. Example - 'AATGATACGGCGACCACCGAGATCTACACGCT; CAAGCAGAAGACGGCATACGAGAT'Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified True STRING ManifestColumn
assemblyName Name/version of the assembly provided by the submitter used in the genome browsers and the community. Example - 'HuRef, JCVI_ISG_3_1.0'Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified True STRING ManifestColumn
assemblyQual Assembly quality. The assembly quality category is based on sets of criteria outlined for each assembly quality category.High Quality- Multiple fragments where gaps span repetitive regions. Presence of the 23S, 16S and 5S rRNA genes and at least 18 tRNAs.Medium Quality- Many fragments with little to no review of assembly other than reporting of standard assembly statistics.Low Quality- Many fragments with little to no review of assembly other than reporting of standard assembly statistics. Assembly statistics include, but are not limited to, total assembly size, number of contigs, contig N50/L50, and maximum contig length. Example values - high-quality genome, medium-quality genome, low-quality genome True STRING ManifestColumn
assemblySoftware Tool(s) used for assembly, including version number and parameters. Example - 'metaSPAdes;3.11.0; kmer set 21,33,55,77,99,121, default parameters otherwise'. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified True STRING ManifestColumn
associatedResource Relevant electronic resources. A related resource that is referenced, cited, or otherwise associated to the sequence. Example - 'http-//www.earthmicrobiome.org/'Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified True STRING ManifestColumn
dataFile Name of additional file(s) accompanying the data. The file(s) provide, for example, the name of any raw files generated by the instrument, generated reports from a vendor, an Rscript, or an instructions document. The files can be instrument raw files, converted peak lists such as mzML, MGF, or result files like mzIdentML. The files can be additional documentation submitted alongside the data needed for reuse and sharing purposes. Provide the file names of any additional files submitted alongside the data (ex., an ADAT file). Multiple file names can be separated by (;)Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified True STRING ManifestColumn
databaseLibrary The name(s) of the associated database library. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified True STRING ManifestColumn
databaseName The name of the search database (nr, SwissProt or est_human, and/or mass spectral library). Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified True STRING ManifestColumn
databaseSource The name of the organization, project, or laboratory from where the database is obtained (UniProt, NCBI, EBI, other). True STRING ManifestColumn
databaseVersion The version of the database. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified True STRING ManifestColumn
databaseWeblink An internet address that may provide details of a database or software search, as well as for labs that generate their own search method (web link). Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified True STRING ManifestColumn
experimentType The type of experiment used. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified True STRING ManifestColumn
experimentalFactor Variable aspects of an experiment design that can be used to describe an experiment or set of experiments in an increasingly detailed manner.This field accepts ontology terms from Experimental Factor Ontology (EFO) and/or Ontology for Biomedical Investigations (OBI). Example - 'time series design [EFO-0001779]'Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified True STRING ManifestColumn
instrumentModel The model of the instrument used. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified True STRING ManifestColumn
libLayout Library layout. Specify whether to expect single, paired, or other configurations of reads. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified True STRING ManifestColumn
libReadsSeqd Library reads sequenced. Total number of clones sequenced from the library. Example - '20'Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified True INTEGER ManifestColumn
libSize Library size. Total number of clones in the library prepared for the project. Example - '50'Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified True INTEGER ManifestColumn
libVector Library vector. Cloning vector type(s) used in the construction of libraries. Example - 'Bacteriophage P1'Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified True STRING ManifestColumn
measurementTechnique The name of the measurement technique describing the assay method. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified True STRING ManifestColumn Bisulfite sequencing,Clinical data,Genome-wide association study,High-performance liquid chromatography tandem mass spectrometry,Liquid chromatography mass spectrometry,Liquid chromatography tandem mass spectrometry,Mass spectrometry,Metabolomics,MetaX-processed metabolomics data,Proximity extension assay,RNA sequencing,Single-cell RNA sequencing,Shotgun metagenomic sequencing,Single nucleotide polymorphism array,Tandem Mass Tag proteomics,Whole-genome sequencing,Unknown,Other,Not collected,Not applicable,Not specified
mid Multiplex identifiers. Molecular barcodes, called Multiplex Identifiers (MIDs), are used to tag unique samples in a sequencing run specifically. Sequence should be reported in uppercase letters. Example - 'GTGAATAT'Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified True STRING ManifestColumn
nucleAcidExt Nucleic acid extraction. A link to a literature reference, electronic resource or a standard operating procedure (SOP), that describes the material separation to recover the nucleic acid fraction from a sample. (example, https-//mobio.com/media/wysiwyg/pdfs/protocols/12888.pdf). Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified True STRING ManifestColumn
numberContig Number of contigs. Total number of contigs in the cleaned/submitted assembly that comprise a given genome, SAG, MAG, or UViG. Example - '40'Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified False INTEGER ManifestColumn
samplePrepProtocol An internet address that may provide more details of the protocol information (web link). Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified True STRING ManifestColumn
sampleType The type of sample collected or the term used to describe the source of a biospecimen used for a laboratory test. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified True STRING ManifestColumn
seqMethod Sequencing method. Sequencing method used; Example - 'Sanger, pyrosequencing, ABI-solid'. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified True STRING ManifestColumn
seqPlatform Sequencing platform information. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified True STRING ManifestColumn
sop Relevant standard operating procedures. Standard operating procedures used in the assembly and/or annotation of genomes, metagenomes, or environmental sequences. Example - 'http-//press.igsb.anl.gov/earthmicrobiome/protocols-and-standards/its/)'Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified True STRING ManifestColumn
sourceMatID Source material identifiers. A unique identifier assigned to a material sample (as defined by http-//rs.tdwg.org/dwc/terms/materialSampleID and as opposed to a particular digital record of a material sample) used for extracting nucleic acids, and subsequent sequencing.The identifier can refer to the original material collected or any derived sub-samples. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified True STRING ManifestColumn
targetGene Targeted gene or locus name for marker gene studies. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified True STRING ManifestColumn
technologyPlatformVersion The specific version (application, manufacturer, model, lab, etc.) of a technology that is used to carry out a laboratory or computational experiment. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified True STRING ManifestColumn
Component False STRING
Filename False STRING
entityID Synapse ID of the entity False STRING Sage Bionetworks
specimenID Identifying string linked to a particular sample or specimen, provide by the data contributor True STRING sage.annotations-experimentalData.specimenID-0.0.2 ManifestColumn
platformLocation The name of the laboratory, facility, vendor, company, or location where the data generation platform was located, provided by the data contributor. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified True STRING sage.annotations-experimentalData.platformLocation-0.0.2 ManifestColumn
libraryPrep The general strategy by which the library was prepared. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified True STRING sage.annotations-ngs.libraryPrep-0.0.13 ManifestColumn amplicon, cellHashing, Chromium Single Cell 3', DNALibraryConstruction, EndItDNAEndRepairKit, KapaHyperPrep, lncRNAenrichment, methylSeq, miRNAenrichment, multiome, MULTIseq, PCRfree, polyAselection, proximity ligation, rRNAdepletion, snIsoSeq, SPLITseq, STARRSeq, SureCell, totalRNA, Unknown, Not collected, Not applicable, Not specified