assay metagenomics template
Template for Metagenomics [Download]
| Attribute | Description | Required | columnType | DependsOn | Source | Parent | Valid Values |
|---|---|---|---|---|---|---|---|
| adapters | Adapters provide priming sequences for both amplification and sequencing of the sample-library fragments. Both adapters should be reported; in uppercase letters. Example - 'AATGATACGGCGACCACCGAGATCTACACGCT; CAAGCAGAAGACGGCATACGAGAT'Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | True | STRING | ManifestColumn | |||
| assemblyName | Name/version of the assembly provided by the submitter used in the genome browsers and the community. Example - 'HuRef, JCVI_ISG_3_1.0'Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | True | STRING | ManifestColumn | |||
| assemblyQual | Assembly quality. The assembly quality category is based on sets of criteria outlined for each assembly quality category.High Quality- Multiple fragments where gaps span repetitive regions. Presence of the 23S, 16S and 5S rRNA genes and at least 18 tRNAs.Medium Quality- Many fragments with little to no review of assembly other than reporting of standard assembly statistics.Low Quality- Many fragments with little to no review of assembly other than reporting of standard assembly statistics. Assembly statistics include, but are not limited to, total assembly size, number of contigs, contig N50/L50, and maximum contig length. Example values - high-quality genome, medium-quality genome, low-quality genome | True | STRING | ManifestColumn | |||
| assemblySoftware | Tool(s) used for assembly, including version number and parameters. Example - 'metaSPAdes;3.11.0; kmer set 21,33,55,77,99,121, default parameters otherwise'. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | True | STRING | ManifestColumn | |||
| associatedResource | Relevant electronic resources. A related resource that is referenced, cited, or otherwise associated to the sequence. Example - 'http-//www.earthmicrobiome.org/'Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | True | STRING | ManifestColumn | |||
| Component | False | ||||||
| databaseLibrary | The name(s) of the associated database library. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | True | STRING | ManifestColumn | |||
| databaseName | The name of the search database (nr, SwissProt or est_human, and/or mass spectral library). Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | True | STRING | ManifestColumn | |||
| databaseSource | The name of the organization, project, or laboratory from where the database is obtained (UniProt, NCBI, EBI, other). | True | STRING | ManifestColumn | |||
| databaseVersion | The version of the database. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | True | STRING | ManifestColumn |
Showing 1 to 10 of 36 entries