Skip to main content Link Menu Expand (external link) Document Search Copy Copied

DataModel

Complete Table of Keys for ELITE that are found in the data model

Key Key Description columnType Source module
isModelSystem BOOLEAN Sage Bionetworks ADKP
DNAextraction DNA extraction kit method. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified STRING ManifestColumn
acquisitionBatchID Acquisition batch identifier, provided by the data contributor to Sage Bionetworks. The batch identifier(s) must be stored in a data dictionary .csv file uploaded to Synapse STRING ManifestColumn
acquisitionBatchSize The number of samples STRING ManifestColumn
acquisitionBatchSizeUnit The unit of measurement for number of samples in a batch STRING ManifestColumn
acquisitionMode The specific aspect of a mass spectrometer method by which mass ranges are selected and possibly dissociated (full scan, MSn, SIM, MRM, etc.). Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified STRING ManifestColumn
acquisitionSoftware The name of the acquisition software used. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified STRING ManifestColumn
acquisitionSoftwareVersion The version number of software used. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified NUMBER ManifestColumn
adapters Adapters provide priming sequences for both amplification and sequencing of the sample-library fragments. Both adapters should be reported; in uppercase letters. Example - 'AATGATACGGCGACCACCGAGATCTACACGCT; CAAGCAGAAGACGGCATACGAGAT'Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified STRING ManifestColumn
adjustedCovariates Any covariates the GWAS is adjusted for. Multiple values can be listed separately by a semicolon (;). Example - age;sex STRING ManifestColumn
arrayInformation Additional information about the genotyping array. For example, for targeted arrays, please provide the specific type of array. Example - Immunochip STRING ManifestColumn
arrayManufacturer Manufacturer of the genotyping array used for the discovery stage. Separate multiple manufacturers by a semicolon (;). Example - Illumina, Affymetrix, Perlegen STRING ManifestColumn
assemblyName Name/version of the assembly provided by the submitter used in the genome browsers and the community. Example - 'HuRef, JCVI_ISG_3_1.0'Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified STRING ManifestColumn
assemblyQual Assembly quality. The assembly quality category is based on sets of criteria outlined for each assembly quality category.High Quality- Multiple fragments where gaps span repetitive regions. Presence of the 23S, 16S and 5S rRNA genes and at least 18 tRNAs.Medium Quality- Many fragments with little to no review of assembly other than reporting of standard assembly statistics.Low Quality- Many fragments with little to no review of assembly other than reporting of standard assembly statistics. Assembly statistics include, but are not limited to, total assembly size, number of contigs, contig N50/L50, and maximum contig length. Example values - high-quality genome, medium-quality genome, low-quality genome STRING ManifestColumn
assemblySoftware Tool(s) used for assembly, including version number and parameters. Example - 'metaSPAdes;3.11.0; kmer set 21,33,55,77,99,121, default parameters otherwise'. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified STRING ManifestColumn
associatedResource Relevant electronic resources. A related resource that is referenced, cited, or otherwise associated to the sequence. Example - 'http-//www.earthmicrobiome.org/'Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified STRING ManifestColumn
backgroundTrait Any background trait(s) shared by all individuals in the GWAS (e.g. in both cases and controls). Example - Nicotine dependence STRING ManifestColumn
batchID ID used to identify a batch, provided by the data contributor to Sage Bionetworks. The batch identifier(s) must be stored in a data dictionary .csv file uploaded to Synapse STRING ManifestColumn
batchLabel Used to supply batch label information with any string value STRING ManifestColumn
captivityDuration The duration of captivity in months for the individuals in captivity (formatted in months, ex. 72 months).note- Applicable only to animals with captivity status captive. STRING ManifestColumn
captivityStatus The status of the individual with regard to captivity.note- Wild, captive, and stranded values are applicable, especially for marine mammals. Depending on life stage terminology for individual species, other values are possible. Please let the data curation team know. STRING ManifestColumn
commonName The biological species common name the individual belongs to (ex. "Horned Lark"). note- As a default, the valid scientific name for the species should be indicated. STRING ManifestColumn
consentGroupID Indicate the consent group for the individual, provided by the data contributor's data dictionary STRING ManifestColumn
conversionRatio The ratio or % detailing how well the bisulfite conversion worked. Provide a value or Unknown Not collected Not applicable Not specified STRING ManifestColumn
conversionRatioUnits The units of measurement. Provide a value or Unknown Not collected Not applicable Not specified STRING ManifestColumn
countryCode Indicate the geographic region for the individual (shown as ex. "840") INTEGER ManifestColumn
dataFile Name of additional file(s) accompanying the data. The file(s) provide, for example, the name of any raw files generated by the instrument, generated reports from a vendor, an Rscript, or an instructions document. The files can be instrument raw files, converted peak lists such as mzML, MGF, or result files like mzIdentML. The files can be additional documentation submitted alongside the data needed for reuse and sharing purposes. Provide the file names of any additional files submitted alongside the data (ex., an ADAT file). Multiple file names can be separated by (;)Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified STRING ManifestColumn
dataModelVersion Version of the data model ManifestColumn
dataTypeAll STRING_LIST Sage Bionetworks ManifestColumn
databaseLibrary The name(s) of the associated database library. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified STRING ManifestColumn
databaseName The name of the search database (nr, SwissProt or est_human, and/or mass spectral library). Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified STRING ManifestColumn
databaseSource The name of the organization, project, or laboratory from where the database is obtained (UniProt, NCBI, EBI, other). STRING ManifestColumn
databaseVersion The version of the database. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified STRING ManifestColumn
databaseWeblink An internet address that may provide details of a database or software search, as well as for labs that generate their own search method (web link). Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified STRING ManifestColumn
diagnosisStatus Whether the individual has been diagnosed with a condition or disease (physical and/or cognitive), \True" indicates the individual has been diagnosed" STRING ManifestColumn
digestionMethod The type of digestion (ex. in-solution, in-gel)Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified STRING ManifestColumn
digestionReagent Enzymes or reagents used for digestion. STRING ManifestColumn
dnaBatchID DNA isolation batch identifier, provided by the data contributor to Sage Bionetworks. The batch identifier(s) must be stored in a data dictionary .csv file uploaded to Synapse. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified STRING ManifestColumn
dnaBatchSize The number of samples. Provide a value or Unknown Not collected Not applicable Not specified STRING ManifestColumn
dnaBatchSizeUnit The unit of measurement for number of samples in a batch STRING ManifestColumn
enrichment Protocol or reagent used for enrichment (ex. Fe3+NTA-Agarose (Qiagen)Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified STRING ManifestColumn
enrichmentMethod The method used for performing an enrichment of specific regions by a restriction enzyme digest. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified STRING ManifestColumn
enrichmentStrategy Type of peptide or protein enrichment STRING ManifestColumn
ethnicGroupCode A coded value specifying the self-declared ethnic origination independent of racial origination, provided by the data contributor's data dictionary STRING ManifestColumn
experimentType The type of experiment used. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified STRING ManifestColumn
experimentalBatchSizeUnit The unit of measurement for number of samples in a experimental batch STRING ManifestColumn
experimentalFactor Variable aspects of an experiment design that can be used to describe an experiment or set of experiments in an increasingly detailed manner.This field accepts ontology terms from Experimental Factor Ontology (EFO) and/or Ontology for Biomedical Investigations (OBI). Example - 'time series design [EFO-0001779]'Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified STRING ManifestColumn
extractionMethod The name of the process used to separate a desired component of an input material from the remainder. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified STRING ManifestColumn
fieldCenterCode Name of the field center STRING ManifestColumn
fractionIdentifier Number of fractions in the experimental runProvide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified STRING ManifestColumn
gasFlowTemperature e.g., nebulization gas, cone gas, etc.Unit of measure-C, F, K, Not specified NUMBER ManifestColumn
gasFlowTemperatureUnit Unit of gas flow temperature STRING ManifestColumn
genotypeTechnology Method(s) used to genotype variants in the discovery stage. Separate multiple methods separated by a semicolon (;). Example - genome-wide genotyping array, exome-wide sequencing, targeted genotyping array STRING ManifestColumn
hasAssayControl Boolean flag indicating whether or not a specimen is a technical or assay control. Examples include study pools or reference pools, blanks, or internal standards. BOOLEAN ManifestColumn
hasIonizationSource Were the ionization conditions recorded to enable reproduction of the experiment? BOOLEAN ManifestColumn
imputation Were SNPs imputed for the discovery GWAS? STRING ManifestColumn
imputationPanel Panel used for imputation. Example - 1000 Genomes Phase 3 STRING ManifestColumn
imputationSoftware Imputation software. Example - IMPUTE STRING ManifestColumn
instrumentModel The model of the instrument used. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified STRING ManifestColumn
ionProperty Ion charge state (positive or negative-ion analysis) STRING ManifestColumn
isobaricLabelingReagent Reagent set used for isobaric labeling. Examples- iTRAQ113 TMT126Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified STRING ManifestColumn
labelFreeQuantitation Type of label-free data analysis strategyProvide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified STRING ManifestColumn
labelQuantitation Type of labeling usedProvide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified STRING ManifestColumn
lensVoltages The skimmer/focusing lens voltages e.g., capillary voltage, etc. NUMBER ManifestColumn
lensVoltagesUnit Unit of lens voltages STRING ManifestColumn
libLayout Library layout. Specify whether to expect single, paired, or other configurations of reads. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified STRING ManifestColumn
libReadsSeqd Library reads sequenced. Total number of clones sequenced from the library. Example - '20'Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified INTEGER ManifestColumn
libSize Library size. Total number of clones in the library prepared for the project. Example - '50'Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified INTEGER ManifestColumn
libVector Library vector. Cloning vector type(s) used in the construction of libraries. Example - 'Bacteriophage P1'Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified STRING ManifestColumn
libraryBatchID Library batch identifier, provided by the data contributor to Sage Bionetworks. The batch identifier(s) must be stored in a data dictionary .csv file uploaded to Synapse. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified STRING ManifestColumn
lifeStage The life stage of the individual.note- Other values are possible depending on life stage terminology for individual species. Please let the data curation team know. STRING ManifestColumn
measurementTechnique The name of the measurement technique describing the assay method. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified STRING ManifestColumn
mid Multiplex identifiers. Molecular barcodes, called Multiplex Identifiers (MIDs), are used to tag unique samples in a sequencing run specifically. Sequence should be reported in uppercase letters. Example - 'GTGAATAT'Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified STRING ManifestColumn
modificationParameters Modification parameters for a search engine run. (ex. PSI- PI http-//www.w3.org/2002/07/owl#Axiom) or used in the peptide identification database search. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified STRING ManifestColumn
msAnalyteType The type of biospecimen subjected to analysis (ex., peptide, protein, metabolite, lipid)Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified STRING ManifestColumn
msAssayTechnique Specified the mass spectrometer technique used or the name of the proteomics assay used (ex. DDA)Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified STRING ManifestColumn
msTarget Specifies whether or not a specific molecule(s) is/are targeted for detection/measurement by the assay STRING ManifestColumn
nucleAcidExt Nucleic acid extraction. A link to a literature reference, electronic resource or a standard operating procedure (SOP), that describes the material separation to recover the nucleic acid fraction from a sample. (example, https-//mobio.com/media/wysiwyg/pdfs/protocols/12888.pdf). Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified STRING ManifestColumn
numberContig Number of contigs. Total number of contigs in the cleaned/submitted assembly that comprise a given genome, SAG, MAG, or UViG. Example - '40'Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified INTEGER ManifestColumn
numberIndividuals Number of individuals in a group. Example - 2000 INTEGER ManifestColumn
processingBatchID Processing batch identifier, provided by the data contributor to Sage Bionetworks. The batch identifier(s) must be stored in a data dictionary .csv file uploaded to Synapse STRING ManifestColumn
program STRING Sage Bionetworks ManifestColumn
projectShortName STRING Sage Bionetworks ManifestColumn
quantationStrategy The general strategy used for differential analysis Example - Absolute quantitation analysis, Isobaric label quantitation analysis, LC-MS label-free quantitation analysis,Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified STRING ManifestColumn
readLengthUnits The units of measurement. Provide a value or Unknown Not collected Not applicable Not specified STRING ManifestColumn
readmeFile The name of any readme file uploaded to Synapse. Example - example.tsv STRING ManifestColumn
reagentCatalogNumber If the assay reagent is a commercial product, enter the vendor's catalog identifier. If the reagent is a custom preparation enter 'NA'. STRING ManifestColumn
reagentContact The contact information is particularly helpful when the reagent is not from a commercial vendor. STRING ManifestColumn
reagentIDs One or more identifiers, separated by a semicolon (;). The reagent identifier(s) must be stored in a data dictionary .csv file uploaded to Synapse. STRING ManifestColumn
reagentLotNumber The lot number is often provided by a reagent source when the reagent is replenished over time. STRING ManifestColumn
reagentManufacturer The manufacturer is the source of a reagent and may include commercial vendors as well as non-commercial sources (e.g., collaborating labs). STRING ManifestColumn
reagentName The reagent name is an alternative to the Reagent ID. STRING ManifestColumn
reagentWeblink An internet address that may provide details of an assay reagent. STRING ManifestColumn
referenceTranscriptID The ID for the transcript/gene. Either the NCBI ID or the Ensembl ID must be provided. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified STRING ManifestColumn
reportedTrait The trait under investigation. Please describe the trait concisely but with enough detail to be clear to a non-specialist. Avoid the use of abbreviations; if these are necessary, please define them or their source in the readme file. Example - Reticulocyte count STRING ManifestColumn
repositoryName The public repository name for the transcript (for example, Ensembl or NCBI Gene) STRING ManifestColumn
resultUnit The unit for the result value STRING ManifestColumn
rnaBatchID Isolation batch identifier, provided by the data contributor to Sage Bionetworks. The batch identifier(s) must be stored in a data dictionary .csv file uploaded to Synapse. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified STRING ManifestColumn
rnaBatchSize The number of samples NUMBER ManifestColumn
rnaBatchSizeUnit The unit of measurement for number of samples in a batch STRING ManifestColumn
sampleBatchID Sample batch lot identifier, provided by the data contributor to Sage Bionetworks. The batch identifier(s) must be stored in a data dictionary .csv file uploaded to Synapse STRING ManifestColumn
sampleIntroduction The sample introduction and delivery. From GC, from LC, direct infusion without chromatography, direct infusion using dedicated autosampler flow rate. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified STRING ManifestColumn
samplePrepProtocol An internet address that may provide more details of the protocol information (web link). Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified STRING ManifestColumn
sampleType The type of sample collected or the term used to describe the source of a biospecimen used for a laboratory test. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified STRING ManifestColumn
seqMethod Sequencing method. Sequencing method used; Example - 'Sanger, pyrosequencing, ABI-solid'. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified STRING ManifestColumn
seqPlatform Sequencing platform information. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified STRING ManifestColumn
sequencingBatchID Sequencing batch identifier, provided by the data contributor to Sage Bionetworks. The batch identifier(s) must be stored in a data dictionary .csv file uploaded to Synapse. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified STRING ManifestColumn
sequencingBatchSize The number of samples. Provide a value or Unknown Not collected Not applicable Not specified STRING ManifestColumn
sequencingBatchSizeUnit The unit of measurement for number of samples in a batch. Provide a value or Unknown Not collected Not applicable Not specified STRING ManifestColumn
sop Relevant standard operating procedures. Standard operating procedures used in the assembly and/or annotation of genomes, metagenomes, or environmental sequences. Example - 'http-//press.igsb.anl.gov/earthmicrobiome/protocols-and-standards/its/)'Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified STRING ManifestColumn
sourceMatID Source material identifiers. A unique identifier assigned to a material sample (as defined by http-//rs.tdwg.org/dwc/terms/materialSampleID and as opposed to a particular digital record of a material sample) used for extracting nucleic acids, and subsequent sequencing.The identifier can refer to the original material collected or any derived sub-samples. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified STRING ManifestColumn
speciesAge Age of individual (formatted in months, ex. "72 months").note- Uncertainty about the age might require recording age by specifying a lower and upper estimate in months for the age of the animal. STRING ManifestColumn
speciesGroup The taxonomic ranking including both species and subspecies the individual belongs to. STRING ManifestColumn
speciesName The scientific name of the species (typically a taxonomic group, ex. "Eremophila alpestris) the individual belongs to.""" STRING ManifestColumn
specimenAge The subject's age at the time of specimen extraction is the individual's age (since birth) at the time a given specimen was extracted. Measured as age in years. Other, Unknown, Not collected, Not applicable STRING ManifestColumn
specimenSource Indicate the biological area of the specimen STRING ManifestColumn
specimenType Type of biological material comprising the Specimen STRING ManifestColumn
stage Stage of the experimental design. STRING ManifestColumn
statisticalModel A brief description of the statistical model used to determine association significance. It is important to distinguish studies that would otherwise appear identical (e.g., the same trait analyzed using additive, dominant, and recessive models). Example - additive model STRING ManifestColumn
studyCode Unique identifier for the study, assigned by the DCC STRING ManifestColumn
studyKey STRING Sage Bionetworks ManifestColumn
summaryFile The name of any summary statistics file uploaded to Synapse. Example - example.tsv STRING ManifestColumn
summaryStatisticsAssembly Genome assembly for the summary statistics. Example - GRCh38 STRING ManifestColumn
targetGene Targeted gene or locus name for marker gene studies. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified STRING ManifestColumn
taxon Taxonomic identifier. The National Center for Biotechnology Information taxon ID (formatted as, ex. "txid9989") STRING ManifestColumn
technologyPlatformVersion The specific version (application, manufacturer, model, lab, etc.) of a technology that is used to carry out a laboratory or computational experiment. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified STRING ManifestColumn
tissueVolume The volume of the tissue sample. Measured in microliters. STRING ManifestColumn
transcriptType The type of transcript reported STRING ManifestColumn
treatmentAmountUnit Unit of treatment amount. NUMBER ManifestColumn
treatmentAmountValue The Amount Value indicates how much (concentration, mass, volume) of a treatment agent was applied to a sample. STRING ManifestColumn
treatmentDurationUnit Unit of treatment duration. STRING ManifestColumn
treatmentDurationValue Duration of treatment. NUMBER ManifestColumn
treatmentIDs One or more identifiers, separated by a semicolon (;). The treatment identifier(s) must be stored in a data dictionary .csv file uploaded to Synapse. STRING ManifestColumn
treatmentName Treatments refer to in vitro modifications of samples. Three treatment types are supported- agent amount, duration, and temperature. The treatment name is an alternate identifier to the Treatment ID. STRING ManifestColumn
treatmentTemperatureUnit Unit of treatment temperature. STRING ManifestColumn
treatmentTemperatureValue Value of treatment temperature. NUMBER ManifestColumn
useReadMeFile Was a readme file uploaded to Synapse? STRING ManifestColumn
useReagent Was a reagent applied to the sample? BOOLEAN ManifestColumn
useSummaryFile Was a summary statitics file uploded to Synapse? STRING ManifestColumn
useTreatment Was a treatment applied to the sample? BOOLEAN ManifestColumn
vacuumPressure The recorded vacuum pressure value NUMBER ManifestColumn
vacuumPressureUnit Unit of vacuum pressure value STRING ManifestColumn
valueReported The count or gene count for the transcript NUMBER ManifestColumn
variantCount The number of variants analysed in the discovery stage (after QC). Example - 52500 STRING ManifestColumn
visitCode Indicate which longitudinal visit for the individual the data comes from, provided by the data contributor's data dictionary NUMBER ManifestColumn
Component Unknown
Filename Unknown
accessReqs Unknown
ackContext Unknown
acknowledgment Unknown
acquistionSoftwareVersion Unknown
batchSizeUnit Unknown
experimentalBatchSize Unknown
grantNumber Unknown
isFeatured Unknown
isReleased Unknown
metadataType Unknown
methods Unknown
newsRelease Unknown
processingBatchSize Unknown
processingBatchSizeUnit Unknown
projectFullName Unknown
relatedStudies Unknown
sampleBatchSize Unknown
sampleBatchSizeUnit Unknown
studyAbstract Unknown
studyDescription Unknown
studyFocus Unknown
studyMetadata Unknown
studyName Unknown
studyType Unknown
studyWiki Unknown
batchSize The number of samples NUMBER sage.annotations-experimentalData.batchSize-0.0.2 batch
cellType Indicate the cell type. STRING sage.annotations-experimentalData.cellType-0.0.9 biospecimen
fastingState Was individual fasting when the sample was taken (true/false)? STRING sage.annotations-experimentalData.fastingState-0.0.2 biospecimen
isPostMortem Was the sample taken after death (true/false)? STRING sage.annotations-experimentalData.isPostMortem-0.0.2 biospecimen
nucleicAcidSource Specifies the type of nucleic acid (DNA, RNA, Pooled, etc.) found in a sample. STRING sage.annotations-ngs.nucleicAcidSource-0.0.3 biospecimen
organ Indicate the organ the specimen is from STRING sage.annotations-experimentalData.organ-0.0.4 biospecimen
samplingAge The calculated age of the sample, measurement is determined or coded by the data contributor.Other,Unknown, Not collected, Not applicable STRING sage.annotations-experimentalData.samplingAge-0.0.2 biospecimen
specimenID Identifying string linked to a particular sample or specimen, provide by the data contributor STRING sage.annotations-experimentalData.specimenID-0.0.2 biospecimen
tissue Indicate the tissue the specimen is from STRING sage.annotations-experimentalData.tissue-0.0.11 biospecimen
tissueWeight The mass of the tissue specimen. Measured in mg. STRING sage.annotations-experimentalData.tissueWeight-0.0.2 biospecimen
diagnosis Indicate the disease or condition. STRING sage.annotations-experimentalData.diagnosis-0.0.12 clinical
ethnicity Ethnicity of individual STRING sage.annotations-demographics.ethnicity-0.0.2 demographics
race Race of individual STRING sage.annotations-demographics.race-0.0.2 demographics
sex The biological sex of the individual STRING sage.annotations-experimentalData.sex-0.0.2 demographics
assay The analysis or technology used to generate the data in this file STRING sage.annotations-experimentalData.assay-0.0.26 experimentalData
controlType Control samples suitable for normalization and batch correction.Possible example values - GIS, GoldenWest, NIST SRM 1950, AIBL pool,Baker pool,water plus Baker ISTD, study pool, internal standards, Other, Unknown, Not collected, Not applicable, Not specified STRING sage.annotations-experimentalData.controlType-0.0.5 experimentalData
platformLocation The name of the laboratory, facility, vendor, company, or location where the data generation platform was located, provided by the data contributor. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified STRING sage.annotations-experimentalData.platformLocation-0.0.2 experimentalData
age Age of the individual (age in years of the individual at first recorded study event (enrollment, visit, observation, sample collection, survey completion, etc.) STRING individual
cohort Name of the cohort the individual belongs to STRING http://purl.obolibrary.org/obo/NCIT_C61512,http://purl.obolibrary.org/obo/STATO_0000203 individual
individualID Identifying string linked to the individual or animal being studied, provided by the data contributor STRING sage.annotations-experimentalData.individualID-0.0.2 individual
species The name of a species (typically a taxonomic group) of organism. STRING_LIST Sage Bionetworks individual
spectrometerFrequency The frequency at which a spectrometer causes hydrogen atoms to resonate (in MHz) NUMBER sage.annotations-experimentalData.spectrometerFrequency-0.0.2 mass spectrometry
directionalBSseqLibrary Indicates whether or not the bisulfiteSeq library is directional STRING sage.annotations-ngs.directionalBSseqLibrary-0.0.2 sequencing
gDNAconc gDNA Concentration in ng. Provide a value or Unknown Not collected Not applicable Not specified STRING sage.annotations-experimentalData.gDNAconc-0.0.3 sequencing
isStranded Whether or not the library is stranded. BOOLEAN sage.annotations-ngs.isStranded-0.0.2 sequencing
lambdaDNAconc Lambda DNA spike-in concentration in ng. Provide a value or Unknown Not collected Not applicable Not specified STRING sage.annotations-experimentalData.lambdaDNAconc-0.0.2 sequencing
libraryPrep The general strategy by which the library was prepared. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified STRING sage.annotations-ngs.libraryPrep-0.0.13 sequencing
libraryPreparationMethod Method by which library was prepared. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified STRING sage.annotations-ngs.libraryPreparationMethod-0.0.10 sequencing
libraryVersion Library Version- for example, rnaSeq 10x library version. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified STRING sage.annotations-ngs.libraryVersion-0.0.2 sequencing
meanCoverage Total number of bases covered by ATAC-seq reads/size of genome. Provide a value or Unknown Not collected Not applicable Not specified STRING sage.annotations-qc.meanCoverage-0.0.2 sequencing
pcrCycles Number of PCR cycles to amplify transposased DNA fragments. Provide a value or Unknown Not collected Not applicable Not specified STRING sage.annotations-experimentalData.pcrCycles-0.0.2 sequencing
readLength The length of the read. Provide a value or Unknown Not collected Not applicable Not specified STRING sage.annotations-ngs.readLength-0.0.2 sequencing
readStrandOrigin The strand from which the read originates in a strand-specific protocol. STRING sage.annotations-ngs.readStrandOrigin-0.0.2 sequencing
runType The type of run STRING sage.annotations-ngs.runType-0.0.2 sequencing
totalReads Total number of sequencing reads from a library. STRING sage.annotations-experimentalData.totalReads-0.0.2 sequencing
assay_RNAseq_template Template for RNAseq Sage Bionetworks template
assay_bsSeq_template Template for bsSeq Sage Bionetworks template
assay_metabolomics_template Template for Metabolomics Sage Bionetworks template
assay_metagenomics_template Template for Metagenomics Sage Bionetworks template
assay_microbiome_template Template for Microbiome Sage Bionetworks template
assay_phenotype_human_template Template for Phenotype_human Sage Bionetworks template
assay_proteomics_template Template for Proteomics Sage Bionetworks template
assay_scRNAseq_template Template for scRNAseq Sage Bionetworks template
assay_whole_genome_sequencing_template Template for Whole_Genome_Sequencing Sage Bionetworks template
biospecimen_human_template Template for Biospecimen_human Sage Bionetworks template
biospecimen_non_human_template Template for Biospecimen_non_Human Sage Bionetworks template
file_annotation_template Base annotations for files in synapse Sage Bionetworks template
genotyping_human_template Template for Genotyping_Human Sage Bionetworks template
individual_human_template Template for Individual_Human Sage Bionetworks template
individual_non_human_template Template for Individual_non_Human Sage Bionetworks template
study_folder_template Annotations for study folders Sage Bionetworks template