ManifestColumn
module in the data model
| Key | Key Description | Valid Values | columnType | Parent | module |
|---|---|---|---|---|---|
| DNAextraction | DNA extraction kit method. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | STRING | ManifestColumn | ManifestColumn | |
| acquisitionBatchID | Acquisition batch identifier, provided by the data contributor to Sage Bionetworks. The batch identifier(s) must be stored in a data dictionary .csv file uploaded to Synapse | STRING | ManifestColumn | ManifestColumn | |
| acquisitionBatchSize | The number of samples | STRING | ManifestColumn | ManifestColumn | |
| acquisitionBatchSizeUnit | The unit of measurement for number of samples in a batch | STRING | ManifestColumn | ManifestColumn | |
| acquisitionMode | The specific aspect of a mass spectrometer method by which mass ranges are selected and possibly dissociated (full scan, MSn, SIM, MRM, etc.). Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | STRING | ManifestColumn | ManifestColumn | |
| acquisitionSoftware | The name of the acquisition software used. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | STRING | ManifestColumn | ManifestColumn | |
| acquisitionSoftwareVersion | The version number of software used. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | NUMBER | ManifestColumn | ManifestColumn | |
| adapters | Adapters provide priming sequences for both amplification and sequencing of the sample-library fragments. Both adapters should be reported; in uppercase letters. Example - 'AATGATACGGCGACCACCGAGATCTACACGCT; CAAGCAGAAGACGGCATACGAGAT'Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | STRING | ManifestColumn | ManifestColumn | |
| adjustedCovariates | Any covariates the GWAS is adjusted for. Multiple values can be listed separately by a semicolon (;). Example - age;sex | STRING | ManifestColumn | ManifestColumn | |
| analysisType | Type of analysis | ANOVA,batch effect correction,clustering,data normalization,de-novo assembly,dose response study,enrichment analysis,genome-wide association,mendelian randomization analysis,network analysis,polygenic risk scores, Not assigned | STRING | ManifestColumn | ManifestColumn |
| arrayInformation | Additional information about the genotyping array. For example, for targeted arrays, please provide the specific type of array. Example - Immunochip | STRING | ManifestColumn | ManifestColumn | |
| arrayManufacturer | Manufacturer of the genotyping array used for the discovery stage. Separate multiple manufacturers by a semicolon (;). Example - Illumina, Affymetrix, Perlegen | STRING | ManifestColumn | ManifestColumn | |
| assemblyName | Name/version of the assembly provided by the submitter used in the genome browsers and the community. Example - 'HuRef, JCVI_ISG_3_1.0'Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | STRING | ManifestColumn | ManifestColumn | |
| assemblyQual | Assembly quality. The assembly quality category is based on sets of criteria outlined for each assembly quality category.High Quality- Multiple fragments where gaps span repetitive regions. Presence of the 23S, 16S and 5S rRNA genes and at least 18 tRNAs.Medium Quality- Many fragments with little to no review of assembly other than reporting of standard assembly statistics.Low Quality- Many fragments with little to no review of assembly other than reporting of standard assembly statistics. Assembly statistics include, but are not limited to, total assembly size, number of contigs, contig N50/L50, and maximum contig length. Example values - high-quality genome, medium-quality genome, low-quality genome | STRING | ManifestColumn | ManifestColumn | |
| assemblySoftware | Tool(s) used for assembly, including version number and parameters. Example - 'metaSPAdes;3.11.0; kmer set 21,33,55,77,99,121, default parameters otherwise'. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | STRING | ManifestColumn | ManifestColumn | |
| associatedResource | Relevant electronic resources. A related resource that is referenced, cited, or otherwise associated to the sequence. Example - 'http-//www.earthmicrobiome.org/'Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | STRING | ManifestColumn | ManifestColumn | |
| backgroundTrait | Any background trait(s) shared by all individuals in the GWAS (e.g. in both cases and controls). Example - Nicotine dependence | STRING | ManifestColumn | ManifestColumn | |
| batchID | ID used to identify a batch, provided by the data contributor to Sage Bionetworks. The batch identifier(s) must be stored in a data dictionary .csv file uploaded to Synapse | STRING | ManifestColumn | ManifestColumn | |
| batchLabel | Used to supply batch label information with any string value | STRING | ManifestColumn | ManifestColumn | |
| captivityDuration | The duration of captivity in months for the individuals in captivity (formatted in months, ex. 72 months).note- Applicable only to animals with captivity status captive. | STRING | ManifestColumn | ManifestColumn | |
| captivityStatus | The status of the individual with regard to captivity.note- Wild, captive, and stranded values are applicable, especially for marine mammals. Depending on life stage terminology for individual species, other values are possible. Please let the data curation team know. | Captive,Stranded,Wild, Not applicable, Not collected, Not specified, Other, Unknown | STRING | ManifestColumn | ManifestColumn |
| commonName | The biological species common name the individual belongs to (ex. "Horned Lark"). note- As a default, the valid scientific name for the species should be indicated. | STRING | ManifestColumn | ManifestColumn | |
| consentGroupID | Indicate the consent group for the individual, provided by the data contributor's data dictionary | STRING | ManifestColumn | ManifestColumn | |
| consortium | The name of the consortium | ELITE, ELITE CDCP, Not assigned | STRING | ManifestColumn | ManifestColumn |
| conversionRatio | The ratio or % detailing how well the bisulfite conversion worked. Provide a value or Unknown Not collected Not applicable Not specified | STRING | ManifestColumn | ManifestColumn | |
| conversionRatioUnits | The units of measurement. Provide a value or Unknown Not collected Not applicable Not specified | STRING | ManifestColumn | ManifestColumn | |
| countryCode | Indicate the geographic region for the individual (shown as ex. "840") | INTEGER | ManifestColumn | ManifestColumn | |
| dataFile | Name of additional file(s) accompanying the data. The file(s) provide, for example, the name of any raw files generated by the instrument, generated reports from a vendor, an Rscript, or an instructions document. The files can be instrument raw files, converted peak lists such as mzML, MGF, or result files like mzIdentML. The files can be additional documentation submitted alongside the data needed for reuse and sharing purposes. Provide the file names of any additional files submitted alongside the data (ex., an ADAT file). Multiple file names can be separated by (;)Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | STRING | ManifestColumn | ManifestColumn | |
| dataModelVersion | Version of the data model | STRING | ManifestColumn | ||
| dataSubtype | Further qualification of dataType, which may be used to indicate the state of processing of the data, aggregation of the data, or presence of metadata | raw,processed,results,normalized,metadata, Not assigned | STRING | ManifestColumn | ManifestColumn |
| dataType | clinical,drugScreen,electrophysiology,epigenetics,geneExpression,genomeAssembly,genomicVariants,imaging,lipidomics,metabolomics,metagenomics,Not applicable,Not collected,Not specified,Other,phenotype,proteomics,Unknown,wearableData | STRING | ManifestColumn | ManifestColumn | |
| dataTypeAll | clinical,drugScreen,electrophysiology,epigenetics,geneExpression,genomeAssembly,genomicVariants,imaging,lipidomics,metabolomics,metagenomics,Not applicable,Not collected,Not specified,Other,phenotype,proteomics,Unknown,wearableData | STRING | ManifestColumn | ManifestColumn | |
| databaseLibrary | The name(s) of the associated database library. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | STRING | ManifestColumn | ManifestColumn | |
| databaseName | The name of the search database (nr, SwissProt or est_human, and/or mass spectral library). Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | STRING | ManifestColumn | ManifestColumn | |
| databaseSource | The name of the organization, project, or laboratory from where the database is obtained (UniProt, NCBI, EBI, other). | STRING | ManifestColumn | ManifestColumn | |
| databaseVersion | The version of the database. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | STRING | ManifestColumn | ManifestColumn | |
| databaseWeblink | An internet address that may provide details of a database or software search, as well as for labs that generate their own search method (web link). Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | STRING | ManifestColumn | ManifestColumn | |
| diagnosisStatus | Whether the individual has been diagnosed with a condition or disease (physical and/or cognitive), \True" indicates the individual has been diagnosed" | FALSE,TRUE | STRING | ManifestColumn | ManifestColumn |
| digestionMethod | The type of digestion (ex. in-solution, in-gel)Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | STRING | ManifestColumn | ManifestColumn | |
| digestionReagent | Enzymes or reagents used for digestion. | 2-iodobenzoate,Arg-C,Asp-N,Asp-N_ambic,Chymotrypsin,CNBr,Formic_acid,Glutamyl endopeptidase,Leukocyte elastase,Lys-C,Lys-C/P,No cleavage,NoEnzyme,Not applicable,Not available,Not collected,Not specified,PepsinA,Proline endopeptidase,TrypChymo,Trypsin,Trypsin/P,Unknown,Unspecific cleavage,V8-DE,V8-E | STRING | ManifestColumn | ManifestColumn |
| dnaBatchID | DNA isolation batch identifier, provided by the data contributor to Sage Bionetworks. The batch identifier(s) must be stored in a data dictionary .csv file uploaded to Synapse. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | STRING | ManifestColumn | ManifestColumn | |
| dnaBatchSize | The number of samples. Provide a value or Unknown Not collected Not applicable Not specified | STRING | ManifestColumn | ManifestColumn | |
| dnaBatchSizeUnit | The unit of measurement for number of samples in a batch | AFU,AI,AU/ml,bp g/dl,DK units/ml,g/l,gm,HAU,IU,iu/l,IU/ml,Kallikrein Inactivator Unit per Milliliter,kg,l,M,mg,mg/dl,mg/l,mg/ml,miu/ml,ml,mM,MOI,ng,ng/dl,ng/ml,ng/nl,ng/ul,nl,nM,Not specified,NPX,optical density,other,PFU,PFUe,pg,pg/mg creatinine,pg/ml,pg/nl,pg/ul,pl,pM,Pound,TCID50,ug,ug/dl,ug/l,ug/ml,ug/ul,uiu/ml,ul,uM,umol/l,units/ml,Unknown,Not collected,Not applicable,Not specified | STRING | ManifestColumn | ManifestColumn |
| enrichment | Protocol or reagent used for enrichment (ex. Fe3+NTA-Agarose (Qiagen)Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | STRING | ManifestColumn | ManifestColumn | |
| enrichmentMethod | The method used for performing an enrichment of specific regions by a restriction enzyme digest. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | STRING | ManifestColumn | ManifestColumn | |
| enrichmentStrategy | Type of peptide or protein enrichment | Acetylome Proteome,Glycoproteome,Lipidome,Metabolome,Not applicable,Not available,Not collected,Not specified,Phosphoproteome,Ubiquitylome,Unknown | STRING | ManifestColumn | ManifestColumn |
| ethnicGroupCode | A coded value specifying the self-declared ethnic origination independent of racial origination, provided by the data contributor's data dictionary | STRING | ManifestColumn | ManifestColumn | |
| experimentType | The type of experiment used. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | STRING | ManifestColumn | ManifestColumn | |
| experimentalBatchSizeUnit | The unit of measurement for number of samples in a experimental batch | STRING | ManifestColumn | ManifestColumn | |
| experimentalFactor | Variable aspects of an experiment design that can be used to describe an experiment or set of experiments in an increasingly detailed manner.This field accepts ontology terms from Experimental Factor Ontology (EFO) and/or Ontology for Biomedical Investigations (OBI). Example - 'time series design [EFO-0001779]'Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | STRING | ManifestColumn | ManifestColumn | |
| extractionMethod | The name of the process used to separate a desired component of an input material from the remainder. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | STRING | ManifestColumn | ManifestColumn | |
| fieldCenterCode | Name of the field center | STRING | ManifestColumn | ManifestColumn | |
| fileFormat | Defined format of the data file, typically corresponding to extension, but sometimes indicating more general group of files produced by the same tool or software | FASTQ, FASTA, SAM, BAM, CRAM, VCF, BCF, GTF, GFF, GFF3, BED, BigBed, WIG, BigWig, CSV, TSV, MTX, H5AD, LOOM, RDS,PED, MAP, BED_PLINK, TPED, TFAM, BEDGRAPH, NARROWPEAK, BROADPEAK, TAGALIGN, OME-TIFF, ND2, CZI, LSM, H5, HDF5, PARQUET, PDB, MMCIF, JSON, YAML, XML, TXT, XLSX, CSV, Not assigned | STRING | ManifestColumn | ManifestColumn |
| fractionIdentifier | Number of fractions in the experimental runProvide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | STRING | ManifestColumn | ManifestColumn | |
| gasFlowTemperature | e.g., nebulization gas, cone gas, etc.Unit of measure-C, F, K, Not specified | NUMBER | ManifestColumn | ManifestColumn | |
| gasFlowTemperatureUnit | Unit of gas flow temperature | C,F,K | STRING | ManifestColumn | ManifestColumn |
| genotypeTechnology | Method(s) used to genotype variants in the discovery stage. Separate multiple methods separated by a semicolon (;). Example - genome-wide genotyping array, exome-wide sequencing, targeted genotyping array | STRING | ManifestColumn | ManifestColumn | |
| hasAssayControl | Boolean flag indicating whether or not a specimen is a technical or assay control. Examples include study pools or reference pools, blanks, or internal standards. | BOOLEAN | ManifestColumn | ManifestColumn | |
| hasIonizationSource | Were the ionization conditions recorded to enable reproduction of the experiment? | No,Yes | BOOLEAN | ManifestColumn | ManifestColumn |
| imputation | Were SNPs imputed for the discovery GWAS? | STRING | ManifestColumn | ManifestColumn | |
| imputationPanel | Panel used for imputation. Example - 1000 Genomes Phase 3 | STRING | ManifestColumn | ManifestColumn | |
| imputationSoftware | Imputation software. Example - IMPUTE | STRING | ManifestColumn | ManifestColumn | |
| instrumentModel | The model of the instrument used. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | STRING | ManifestColumn | ManifestColumn | |
| ionProperty | Ion charge state (positive or negative-ion analysis) | Negative,Positive | STRING | ManifestColumn | ManifestColumn |
| isobaricLabelingReagent | Reagent set used for isobaric labeling. Examples- iTRAQ113 TMT126Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | STRING | ManifestColumn | ManifestColumn | |
| labelFreeQuantitation | Type of label-free data analysis strategyProvide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | Label-free gene level quantitation,Label-free peptide level quantitation,Label-free protein group level quantitation,Label-free protein level quantitation,Label-free raw feature quantitation,Not applicable,Not available,Not collected,Not specified,Unknown | STRING | ManifestColumn | ManifestColumn |
| labelQuantitation | Type of labeling usedProvide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | AminoxyTMT,DiART,DiLeu,Glyco-TMT,Hydrazide TMT,IodoTMT,IPTL,iTRAQ,iTRAQH,Label Free,Not available,Not collected,Not specified,TMT,Unknown | STRING | ManifestColumn | ManifestColumn |
| lensVoltages | The skimmer/focusing lens voltages e.g., capillary voltage, etc. | NUMBER | ManifestColumn | ManifestColumn | |
| lensVoltagesUnit | Unit of lens voltages | STRING | ManifestColumn | ManifestColumn | |
| libLayout | Library layout. Specify whether to expect single, paired, or other configurations of reads. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | STRING | ManifestColumn | ManifestColumn | |
| libReadsSeqd | Library reads sequenced. Total number of clones sequenced from the library. Example - '20'Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | INTEGER | ManifestColumn | ManifestColumn | |
| libSize | Library size. Total number of clones in the library prepared for the project. Example - '50'Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | INTEGER | ManifestColumn | ManifestColumn | |
| libVector | Library vector. Cloning vector type(s) used in the construction of libraries. Example - 'Bacteriophage P1'Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | STRING | ManifestColumn | ManifestColumn | |
| libraryBatchID | Library batch identifier, provided by the data contributor to Sage Bionetworks. The batch identifier(s) must be stored in a data dictionary .csv file uploaded to Synapse. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | STRING | ManifestColumn | ManifestColumn | |
| lifeStage | The life stage of the individual.note- Other values are possible depending on life stage terminology for individual species. Please let the data curation team know. | Adult,Juvenile,Post-Juvenile, Not applicable, Not collected, Not specified, Other, Unknown | STRING | ManifestColumn | ManifestColumn |
| measurementTechnique | The name of the measurement technique describing the assay method. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | STRING | ManifestColumn | ManifestColumn | |
| mid | Multiplex identifiers. Molecular barcodes, called Multiplex Identifiers (MIDs), are used to tag unique samples in a sequencing run specifically. Sequence should be reported in uppercase letters. Example - 'GTGAATAT'Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | STRING | ManifestColumn | ManifestColumn | |
| modificationParameters | Modification parameters for a search engine run. (ex. PSI- PI http-//www.w3.org/2002/07/owl#Axiom) or used in the peptide identification database search. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | STRING | ManifestColumn | ManifestColumn | |
| msAnalyteType | The type of biospecimen subjected to analysis (ex., peptide, protein, metabolite, lipid)Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | STRING | ManifestColumn | ManifestColumn | |
| msAssayTechnique | Specified the mass spectrometer technique used or the name of the proteomics assay used (ex. DDA)Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | STRING | ManifestColumn | ManifestColumn | |
| msTarget | Specifies whether or not a specific molecule(s) is/are targeted for detection/measurement by the assay | Not applicable,Not available,Not collected,Not specified,Targeted,Unknown,Untargeted | STRING | ManifestColumn | ManifestColumn |
| nucleAcidExt | Nucleic acid extraction. A link to a literature reference, electronic resource or a standard operating procedure (SOP), that describes the material separation to recover the nucleic acid fraction from a sample. (example, https-//mobio.com/media/wysiwyg/pdfs/protocols/12888.pdf). Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | STRING | ManifestColumn | ManifestColumn | |
| numberContig | Number of contigs. Total number of contigs in the cleaned/submitted assembly that comprise a given genome, SAG, MAG, or UViG. Example - '40'Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | INTEGER | ManifestColumn | ManifestColumn | |
| numberIndividuals | Number of individuals in a group. Example - 2000 | INTEGER | ManifestColumn | ManifestColumn | |
| processingBatchID | Processing batch identifier, provided by the data contributor to Sage Bionetworks. The batch identifier(s) must be stored in a data dictionary .csv file uploaded to Synapse | STRING | ManifestColumn | ManifestColumn | |
| program | ELITE,AD | STRING | ManifestColumn | ManifestColumn | |
| projectShortName | LC,ILO,LLFS,LG, Not assigned | STRING | ManifestColumn | ManifestColumn | |
| quantationStrategy | The general strategy used for differential analysis Example - Absolute quantitation analysis, Isobaric label quantitation analysis, LC-MS label-free quantitation analysis,Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | STRING | ManifestColumn | ManifestColumn | |
| readLengthUnits | The units of measurement. Provide a value or Unknown Not collected Not applicable Not specified | STRING | ManifestColumn | ManifestColumn | |
| readmeFile | The name of any readme file uploaded to Synapse. Example - example.tsv | STRING | ManifestColumn | ManifestColumn | |
| reagentCatalogNumber | If the assay reagent is a commercial product, enter the vendor's catalog identifier. If the reagent is a custom preparation enter 'NA'. | STRING | ManifestColumn | ManifestColumn | |
| reagentContact | The contact information is particularly helpful when the reagent is not from a commercial vendor. | STRING | ManifestColumn | ManifestColumn | |
| reagentIDs | One or more identifiers, separated by a semicolon (;). The reagent identifier(s) must be stored in a data dictionary .csv file uploaded to Synapse. | STRING | ManifestColumn | ManifestColumn | |
| reagentLotNumber | The lot number is often provided by a reagent source when the reagent is replenished over time. | STRING | ManifestColumn | ManifestColumn | |
| reagentManufacturer | The manufacturer is the source of a reagent and may include commercial vendors as well as non-commercial sources (e.g., collaborating labs). | STRING | ManifestColumn | ManifestColumn | |
| reagentName | The reagent name is an alternative to the Reagent ID. | STRING | ManifestColumn | ManifestColumn | |
| reagentWeblink | An internet address that may provide details of an assay reagent. | STRING | ManifestColumn | ManifestColumn | |
| referenceTranscriptID | The ID for the transcript/gene. Either the NCBI ID or the Ensembl ID must be provided. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | STRING | ManifestColumn | ManifestColumn | |
| reportedTrait | The trait under investigation. Please describe the trait concisely but with enough detail to be clear to a non-specialist. Avoid the use of abbreviations; if these are necessary, please define them or their source in the readme file. Example - Reticulocyte count | STRING | ManifestColumn | ManifestColumn | |
| repositoryName | The public repository name for the transcript (for example, Ensembl or NCBI Gene) | ArrayExpress,Broad Single Cell Portal,dbGAP,ENA,Ensembl,FlowRepository,GenBank,GENCODEv38,GRCh38,GEO,GISAID,IEDB,ImmPort,MassIVE,MetaboLights,Metabolomics Workbench,MGnify,NCBI Gene,PRIDE,SRA,Synapse,UniProt,Other,Unknown,Not collected,Not applicable,Not specified | STRING | ManifestColumn | ManifestColumn |
| resourceType | The type of resource being stored and annotated | experimentalData,metadata,tool,analysis,computationalNotebook,softwareTool,Not assigned | STRING | ManifestColumn | ManifestColumn |
| resultUnit | The unit for the result value | FPKM,raw count, Not applicable,Not collected,Not specified,RPKM,TPM,Unknown | STRING | ManifestColumn | ManifestColumn |
| rnaBatchID | Isolation batch identifier, provided by the data contributor to Sage Bionetworks. The batch identifier(s) must be stored in a data dictionary .csv file uploaded to Synapse. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | STRING | ManifestColumn | ManifestColumn | |
| rnaBatchSize | The number of samples | NUMBER | ManifestColumn | ManifestColumn | |
| rnaBatchSizeUnit | The unit of measurement for number of samples in a batch | AFU,AI,AU/ml,bp g/dl,DK units/ml,g/l,gm,HAU,IU,iu/l,IU/ml,Kallikrein Inactivator Unit per Milliliter,kg,l,M,mg,mg/dl,mg/l,mg/ml,miu/ml,ml,mM,MOI,ng,ng/dl,ng/ml,ng/nl,ng/ul,nl,nM,Not specified,NPX,optical density,other,PFU,PFUe,pg,pg/mg creatinine,pg/ml,pg/nl,pg/ul,pl,pM,Pound,TCID50,ug,ug/dl,ug/l,ug/ml,ug/ul,uiu/ml,ul,uM,umol/l,units/ml | STRING | ManifestColumn | ManifestColumn |
| sampleBatchID | Sample batch lot identifier, provided by the data contributor to Sage Bionetworks. The batch identifier(s) must be stored in a data dictionary .csv file uploaded to Synapse | STRING | ManifestColumn | ManifestColumn | |
| sampleIntroduction | The sample introduction and delivery. From GC, from LC, direct infusion without chromatography, direct infusion using dedicated autosampler flow rate. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | STRING | ManifestColumn | ManifestColumn | |
| samplePrepProtocol | An internet address that may provide more details of the protocol information (web link). Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | STRING | ManifestColumn | ManifestColumn | |
| sampleType | The type of sample collected or the term used to describe the source of a biospecimen used for a laboratory test. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | STRING | ManifestColumn | ManifestColumn | |
| seqMethod | Sequencing method. Sequencing method used; Example - 'Sanger, pyrosequencing, ABI-solid'. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | STRING | ManifestColumn | ManifestColumn | |
| seqPlatform | Sequencing platform information. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | STRING | ManifestColumn | ManifestColumn | |
| sequencingBatchID | Sequencing batch identifier, provided by the data contributor to Sage Bionetworks. The batch identifier(s) must be stored in a data dictionary .csv file uploaded to Synapse. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | STRING | ManifestColumn | ManifestColumn | |
| sequencingBatchSize | The number of samples. Provide a value or Unknown Not collected Not applicable Not specified | STRING | ManifestColumn | ManifestColumn | |
| sequencingBatchSizeUnit | The unit of measurement for number of samples in a batch. Provide a value or Unknown Not collected Not applicable Not specified | STRING | ManifestColumn | ManifestColumn | |
| sop | Relevant standard operating procedures. Standard operating procedures used in the assembly and/or annotation of genomes, metagenomes, or environmental sequences. Example - 'http-//press.igsb.anl.gov/earthmicrobiome/protocols-and-standards/its/)'Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | STRING | ManifestColumn | ManifestColumn | |
| sourceMatID | Source material identifiers. A unique identifier assigned to a material sample (as defined by http-//rs.tdwg.org/dwc/terms/materialSampleID and as opposed to a particular digital record of a material sample) used for extracting nucleic acids, and subsequent sequencing.The identifier can refer to the original material collected or any derived sub-samples. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | STRING | ManifestColumn | ManifestColumn | |
| speciesAge | Age of individual (formatted in months, ex. "72 months").note- Uncertainty about the age might require recording age by specifying a lower and upper estimate in months for the age of the animal. | STRING | ManifestColumn | ManifestColumn | |
| speciesGroup | The taxonomic ranking including both species and subspecies the individual belongs to. | Amphibian,Bird,Fish,Invertebrate,Mammal,Not applicable,Not collected,Not specified,Reptile,Unknown | STRING | ManifestColumn | ManifestColumn |
| speciesName | The scientific name of the species (typically a taxonomic group, ex. "Eremophila alpestris) the individual belongs to.""" | Acomys cahirinus, Acomys russatus, Accipiter cooperii, Actitis macularius, Aix sponsa, Anas acuta, Anas carolinensis, Anas platyrhynchos, Antigone canadensis, Archilochus colubris, Artibeus jamaicensis, Baeolophus bicolor, Balaena mysticetus, Blarina brevicauda, Bombycilla cedrorum, Bonasa umbellus, Bos taurus, Branta canadensis, Bubo virginianus, Buteo jamaicensis, Buteo lineatus, Canis latrans, Cardinalis cardinalis, Castor canadensis, Cavia porcellus, Charadrius vociferus, Chinchilla lanigera, Columba livia, Condylura cristata, Corvus brachyrhynchos, Cricetomys ansorgei, Cricetulus barabensis, Cricetulus griseus, Cryptomys damarensis, Cuniculus paca, Cyanocitta cristata, Cygnus olor, Dryobates pubescens, Dumetella carolinensis, Ellobius lutescens, Ellobius talpinus, Eonycteris spelaea, Eptesicus fuscus, Equus caballus, Eremophila alpestris, Fukomys damarensis, Haemorhous mexicanus, Heterocephalus glaber, Hirundo rustica, Homo sapiens, Hydrochoerus hydrochaeris, Hydroprogne caspia, Hylocichla mustelina, Icteria virens, Larus argentatus, Larus delawarensis, Macaca fascicularis, Macaca mulatta, Mareca strepera, Marmota monax, Melanerpes carolinus, Meleagris gallopavo, Melospiza melodia, Meriones unguiculatus, Mesocricetus auratus, Microtus pennsylvanicus, Mimus polyglottos, Molothrus ater, Multi-species, Mus musculus, Myocastor coypus, Myotis lucifugus, Nannospalax galili, Neosciurus carolinensis, Neotoma cinerea, Neotoma floridana, Not applicable, Not collected, Not provided, Not specified, Octodon degus, Odocoileus virginianus, Ondatra zibethicus, Other, Pan troglodytes, Papio anubis, Passer domesticus, Passerina caerulea, Passerina cyanea, Peromyscus gossypinus, Peromyscus leucopus, Peromyscus maniculatus, Phalacrocorax auritus, Phasianus colchicus, Picoides villosus, Pipilo erythrophthalmus, Poecile carolinensis, Quiscalus quiscula, Rattus norvegicus, Rattus rattus, Regulus calendula, Saimiri boliviensis, Sayornis phoebe, Scalopus aquaticus, Sciurus carolinensis, Sciurus niger, Sciurus vulgaris, Scolopax minor, Setophaga citrina, Setophaga coronata, Setophaga dominica, Setophaga petechia, Setophaga pinus, Sialia sialis, Sigmodon hispidus, Sitta carolinensis, Spatula clypeata, Spinus tristis, Spizella passerina, Spizella pusilla, Spizelloides arborea, Struthio camelus, Sturnus vulgaris, Sus scrofa, Sylvilagus floridanus, Tachycineta bicolor, Tamias striatus, Tamiasciurus hudsonicus, Thryothorus ludovicianus, Toxostoma rufum, Troglodytes aedon, Turdus migratorius, Tursiops truncatus, Vicugna pacos, Vireo griseus, Vireo olivaceus, Zalophus californianus, Zenaida macroura, Zonotrichia albicollis, Unknown | STRING | ManifestColumn | ManifestColumn |
| specimenAge | The subject's age at the time of specimen extraction is the individual's age (since birth) at the time a given specimen was extracted. Measured as age in years. Other, Unknown, Not collected, Not applicable | STRING | ManifestColumn | ManifestColumn | |
| specimenSource | Indicate the biological area of the specimen | STRING | ManifestColumn | ManifestColumn | |
| specimenType | Type of biological material comprising the Specimen | blood,Cerebrospinal Fluid (CSF),Not applicable,Not collected,Not specified,organoid,plasma,saliva,serum,sputum,stool,swabs,tissue,Unknown,urine | STRING | ManifestColumn | ManifestColumn |
| stage | Stage of the experimental design. | Discovery,Not applicable,Not collected,Not specified,Other,Replication,Unknown | STRING | ManifestColumn | ManifestColumn |
| statisticalModel | A brief description of the statistical model used to determine association significance. It is important to distinguish studies that would otherwise appear identical (e.g., the same trait analyzed using additive, dominant, and recessive models). Example - additive model | STRING | ManifestColumn | ManifestColumn | |
| studyCode | Unique identifier for the study, assigned by the DCC | CDCP,ILO,LC,LG,LLFS,Other | STRING | ManifestColumn | ManifestColumn |
| studyKey | The short acronym for a study name in a URL-friendly format (ex. LLFS_Metabolomics OR ELPSCRNA) | STRING | ManifestColumn | ManifestColumn | |
| summaryFile | The name of any summary statistics file uploaded to Synapse. Example - example.tsv | STRING | ManifestColumn | ManifestColumn | |
| summaryStatisticsAssembly | Genome assembly for the summary statistics. Example - GRCh38 | STRING | ManifestColumn | ManifestColumn | |
| targetGene | Targeted gene or locus name for marker gene studies. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | STRING | ManifestColumn | ManifestColumn | |
| taxon | Taxonomic identifier. The National Center for Biotechnology Information taxon ID (formatted as, ex. "txid9989") | STRING | ManifestColumn | ManifestColumn | |
| technologyPlatformVersion | The specific version (application, manufacturer, model, lab, etc.) of a technology that is used to carry out a laboratory or computational experiment. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | STRING | ManifestColumn | ManifestColumn | |
| tissueVolume | The volume of the tissue sample. Measured in microliters. | STRING | ManifestColumn | ManifestColumn | |
| transcriptType | The type of transcript reported | lincRNA,mRNA,total RNA minus rRNA,Not applicable,Not collected,Not specified,Other,snRNA,Unknown | STRING | ManifestColumn | ManifestColumn |
| treatmentAmountUnit | Unit of treatment amount. | AFU,AI,AU/ml,DK units/ml,g/dl,g/l,gm,HAU,IU,iu/l,IU/ml,Kallikrein Inactivator Unit per Milliliter,kg,l,M,mg,mg/dl,mg/l,mg/ml,miu/ml,ml,mM,MOI,ng,ng/dl,ng/ml,ng/nl,ng/ul,nl,nM,Not specified,NPX,optical density,other,PFU,PFUe,pg,pg/mg creatinine,pg/ml,pg/nl,pg/ul,pl,pM,Pound,TCID50,ug,ug/dl,ug/l,ug/ml,ug/ul,uiu/ml,ul,uM,umol/l,units/ml | NUMBER | ManifestColumn | ManifestColumn |
| treatmentAmountValue | The Amount Value indicates how much (concentration, mass, volume) of a treatment agent was applied to a sample. | STRING | ManifestColumn | ManifestColumn | |
| treatmentDurationUnit | Unit of treatment duration. | d.p.c.,Days,Hours,Minutes,Months,Not applicable,Not collected,Not specified,Seconds,Unknown,Weeks,Years | STRING | ManifestColumn | ManifestColumn |
| treatmentDurationValue | Duration of treatment. | NUMBER | ManifestColumn | ManifestColumn | |
| treatmentIDs | One or more identifiers, separated by a semicolon (;). The treatment identifier(s) must be stored in a data dictionary .csv file uploaded to Synapse. | STRING | ManifestColumn | ManifestColumn | |
| treatmentName | Treatments refer to in vitro modifications of samples. Three treatment types are supported- agent amount, duration, and temperature. The treatment name is an alternate identifier to the Treatment ID. | STRING | ManifestColumn | ManifestColumn | |
| treatmentTemperatureUnit | Unit of treatment temperature. | C,F,K,Not specified | STRING | ManifestColumn | ManifestColumn |
| treatmentTemperatureValue | Value of treatment temperature. | NUMBER | ManifestColumn | ManifestColumn | |
| useReadMeFile | Was a readme file uploaded to Synapse? | STRING | ManifestColumn | ManifestColumn | |
| useReagent | Was a reagent applied to the sample? | FALSE,TRUE | BOOLEAN | ManifestColumn | ManifestColumn |
| useSummaryFile | Was a summary statitics file uploded to Synapse? | STRING | ManifestColumn | ManifestColumn | |
| useTreatment | Was a treatment applied to the sample? | BOOLEAN | ManifestColumn | ManifestColumn | |
| vacuumPressure | The recorded vacuum pressure value | NUMBER | ManifestColumn | ManifestColumn | |
| vacuumPressureUnit | Unit of vacuum pressure value | AFU,AI,AU/ml,bp g/dl,DK units/ml,g/l,gm,HAU,IU,iu/l,IU/ml,Kallikrein Inactivator Unit per Milliliter,kg,l,M,mg,mg/dl,mg/l,mg/ml,miu/ml,ml,mM,MOI,ng,ng/dl,ng/ml,ng/nl,ng/ul,nl,nM,Not specified,NPX,optical density,PFU,PFUe,pg,pg/mg creatinine,pg/ml,pg/nl,pg/ul,pl,pM,Pound,TCID50,ug,ug/dl,ug/l,ug/ml,ug/ul,uiu/ml,ul,uM,umol/l,units/ml | STRING | ManifestColumn | ManifestColumn |
| valueReported | The count or gene count for the transcript | STRING | ManifestColumn | ManifestColumn | |
| variantCount | The number of variants analysed in the discovery stage (after QC). Example - 52500 | STRING | ManifestColumn | ManifestColumn | |
| visitCode | Indicate which longitudinal visit for the individual the data comes from, provided by the data contributor's data dictionary | NUMBER | ManifestColumn | ManifestColumn |