Skip to main content Link Menu Expand (external link) Document Search Copy Copied

ManifestColumn

module in the data model

Key Key Description Valid Values columnType Parent module
DNAextraction DNA extraction kit method. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified STRING ManifestColumn ManifestColumn
acquisitionBatchID Acquisition batch identifier, provided by the data contributor to Sage Bionetworks. The batch identifier(s) must be stored in a data dictionary .csv file uploaded to Synapse STRING ManifestColumn ManifestColumn
acquisitionBatchSize The number of samples STRING ManifestColumn ManifestColumn
acquisitionBatchSizeUnit The unit of measurement for number of samples in a batch STRING ManifestColumn ManifestColumn
acquisitionMode The specific aspect of a mass spectrometer method by which mass ranges are selected and possibly dissociated (full scan, MSn, SIM, MRM, etc.). Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified STRING ManifestColumn ManifestColumn
acquisitionSoftware The name of the acquisition software used. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified STRING ManifestColumn ManifestColumn
acquisitionSoftwareVersion The version number of software used. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified NUMBER ManifestColumn ManifestColumn
adapters Adapters provide priming sequences for both amplification and sequencing of the sample-library fragments. Both adapters should be reported; in uppercase letters. Example - 'AATGATACGGCGACCACCGAGATCTACACGCT; CAAGCAGAAGACGGCATACGAGAT'Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified STRING ManifestColumn ManifestColumn
adjustedCovariates Any covariates the GWAS is adjusted for. Multiple values can be listed separately by a semicolon (;). Example - age;sex STRING ManifestColumn ManifestColumn
analysisType Type of analysis ANOVA,batch effect correction,clustering,data normalization,de-novo assembly,dose response study,enrichment analysis,genome-wide association,mendelian randomization analysis,network analysis,polygenic risk scores, Not assigned STRING ManifestColumn ManifestColumn
arrayInformation Additional information about the genotyping array. For example, for targeted arrays, please provide the specific type of array. Example - Immunochip STRING ManifestColumn ManifestColumn
arrayManufacturer Manufacturer of the genotyping array used for the discovery stage. Separate multiple manufacturers by a semicolon (;). Example - Illumina, Affymetrix, Perlegen STRING ManifestColumn ManifestColumn
assemblyName Name/version of the assembly provided by the submitter used in the genome browsers and the community. Example - 'HuRef, JCVI_ISG_3_1.0'Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified STRING ManifestColumn ManifestColumn
assemblyQual Assembly quality. The assembly quality category is based on sets of criteria outlined for each assembly quality category.High Quality- Multiple fragments where gaps span repetitive regions. Presence of the 23S, 16S and 5S rRNA genes and at least 18 tRNAs.Medium Quality- Many fragments with little to no review of assembly other than reporting of standard assembly statistics.Low Quality- Many fragments with little to no review of assembly other than reporting of standard assembly statistics. Assembly statistics include, but are not limited to, total assembly size, number of contigs, contig N50/L50, and maximum contig length. Example values - high-quality genome, medium-quality genome, low-quality genome STRING ManifestColumn ManifestColumn
assemblySoftware Tool(s) used for assembly, including version number and parameters. Example - 'metaSPAdes;3.11.0; kmer set 21,33,55,77,99,121, default parameters otherwise'. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified STRING ManifestColumn ManifestColumn
associatedResource Relevant electronic resources. A related resource that is referenced, cited, or otherwise associated to the sequence. Example - 'http-//www.earthmicrobiome.org/'Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified STRING ManifestColumn ManifestColumn
backgroundTrait Any background trait(s) shared by all individuals in the GWAS (e.g. in both cases and controls). Example - Nicotine dependence STRING ManifestColumn ManifestColumn
batchID ID used to identify a batch, provided by the data contributor to Sage Bionetworks. The batch identifier(s) must be stored in a data dictionary .csv file uploaded to Synapse STRING ManifestColumn ManifestColumn
batchLabel Used to supply batch label information with any string value STRING ManifestColumn ManifestColumn
captivityDuration The duration of captivity in months for the individuals in captivity (formatted in months, ex. 72 months).note- Applicable only to animals with captivity status captive. STRING ManifestColumn ManifestColumn
captivityStatus The status of the individual with regard to captivity.note- Wild, captive, and stranded values are applicable, especially for marine mammals. Depending on life stage terminology for individual species, other values are possible. Please let the data curation team know. Captive,Stranded,Wild, Not applicable, Not collected, Not specified, Other, Unknown STRING ManifestColumn ManifestColumn
commonName The biological species common name the individual belongs to (ex. "Horned Lark"). note- As a default, the valid scientific name for the species should be indicated. STRING ManifestColumn ManifestColumn
consentGroupID Indicate the consent group for the individual, provided by the data contributor's data dictionary STRING ManifestColumn ManifestColumn
consortium The name of the consortium ELITE, ELITE CDCP, Not assigned STRING ManifestColumn ManifestColumn
conversionRatio The ratio or % detailing how well the bisulfite conversion worked. Provide a value or Unknown Not collected Not applicable Not specified STRING ManifestColumn ManifestColumn
conversionRatioUnits The units of measurement. Provide a value or Unknown Not collected Not applicable Not specified STRING ManifestColumn ManifestColumn
countryCode Indicate the geographic region for the individual (shown as ex. "840") INTEGER ManifestColumn ManifestColumn
dataFile Name of additional file(s) accompanying the data. The file(s) provide, for example, the name of any raw files generated by the instrument, generated reports from a vendor, an Rscript, or an instructions document. The files can be instrument raw files, converted peak lists such as mzML, MGF, or result files like mzIdentML. The files can be additional documentation submitted alongside the data needed for reuse and sharing purposes. Provide the file names of any additional files submitted alongside the data (ex., an ADAT file). Multiple file names can be separated by (;)Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified STRING ManifestColumn ManifestColumn
dataModelVersion Version of the data model STRING ManifestColumn
dataSubtype Further qualification of dataType, which may be used to indicate the state of processing of the data, aggregation of the data, or presence of metadata raw,processed,results,normalized,metadata, Not assigned STRING ManifestColumn ManifestColumn
dataType The category or format of data generated or collected in an experiment, describing the kind of information the dataset contains (for example, genomics, imaging, proteomics, or behavioral data). clinical,drugScreen,electrophysiology,epigenetics,geneExpression,genomeAssembly,genomicVariants,imaging,lipidomics,metabolomics,metagenomics,Not applicable,Not collected,Not specified,Other,phenotype,proteomics,Unknown,wearableData STRING_LIST ManifestColumn ManifestColumn
dataTypeAll clinical,drugScreen,electrophysiology,epigenetics,geneExpression,genomeAssembly,genomicVariants,imaging,lipidomics,metabolomics,metagenomics,Not applicable,Not collected,Not specified,Other,phenotype,proteomics,Unknown,wearableData STRING ManifestColumn ManifestColumn
databaseLibrary The name(s) of the associated database library. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified STRING ManifestColumn ManifestColumn
databaseName The name of the search database (nr, SwissProt or est_human, and/or mass spectral library). Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified STRING ManifestColumn ManifestColumn
databaseSource The name of the organization, project, or laboratory from where the database is obtained (UniProt, NCBI, EBI, other). STRING ManifestColumn ManifestColumn
databaseVersion The version of the database. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified STRING ManifestColumn ManifestColumn
databaseWeblink An internet address that may provide details of a database or software search, as well as for labs that generate their own search method (web link). Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified STRING ManifestColumn ManifestColumn
diagnosisStatus Whether the individual has been diagnosed with a condition or disease (physical and/or cognitive), \True" indicates the individual has been diagnosed" FALSE,TRUE STRING ManifestColumn ManifestColumn
digestionMethod The type of digestion (ex. in-solution, in-gel)Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified STRING ManifestColumn ManifestColumn
digestionReagent Enzymes or reagents used for digestion. 2-iodobenzoate,Arg-C,Asp-N,Asp-N_ambic,Chymotrypsin,CNBr,Formic_acid,Glutamyl endopeptidase,Leukocyte elastase,Lys-C,Lys-C/P,No cleavage,NoEnzyme,Not applicable,Not available,Not collected,Not specified,PepsinA,Proline endopeptidase,TrypChymo,Trypsin,Trypsin/P,Unknown,Unspecific cleavage,V8-DE,V8-E STRING ManifestColumn ManifestColumn
dnaBatchID DNA isolation batch identifier, provided by the data contributor to Sage Bionetworks. The batch identifier(s) must be stored in a data dictionary .csv file uploaded to Synapse. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified STRING ManifestColumn ManifestColumn
dnaBatchSize The number of samples. Provide a value or Unknown Not collected Not applicable Not specified STRING ManifestColumn ManifestColumn
dnaBatchSizeUnit The unit of measurement for number of samples in a batch AFU,AI,AU/ml,bp g/dl,DK units/ml,g/l,gm,HAU,IU,iu/l,IU/ml,Kallikrein Inactivator Unit per Milliliter,kg,l,M,mg,mg/dl,mg/l,mg/ml,miu/ml,ml,mM,MOI,ng,ng/dl,ng/ml,ng/nl,ng/ul,nl,nM,Not specified,NPX,optical density,other,PFU,PFUe,pg,pg/mg creatinine,pg/ml,pg/nl,pg/ul,pl,pM,Pound,TCID50,ug,ug/dl,ug/l,ug/ml,ug/ul,uiu/ml,ul,uM,umol/l,units/ml,Unknown,Not collected,Not applicable,Not specified STRING ManifestColumn ManifestColumn
enrichment Protocol or reagent used for enrichment (ex. Fe3+NTA-Agarose (Qiagen)Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified STRING ManifestColumn ManifestColumn
enrichmentMethod The method used for performing an enrichment of specific regions by a restriction enzyme digest. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified STRING ManifestColumn ManifestColumn
enrichmentStrategy Type of peptide or protein enrichment Acetylome Proteome,Glycoproteome,Lipidome,Metabolome,Not applicable,Not available,Not collected,Not specified,Phosphoproteome,Ubiquitylome,Unknown STRING ManifestColumn ManifestColumn
ethnicGroupCode A coded value specifying the self-declared ethnic origination independent of racial origination, provided by the data contributor's data dictionary STRING ManifestColumn ManifestColumn
experimentType The type of experiment used. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified STRING ManifestColumn ManifestColumn
experimentalBatchSizeUnit The unit of measurement for number of samples in a experimental batch STRING ManifestColumn ManifestColumn
experimentalFactor Variable aspects of an experiment design that can be used to describe an experiment or set of experiments in an increasingly detailed manner.This field accepts ontology terms from Experimental Factor Ontology (EFO) and/or Ontology for Biomedical Investigations (OBI). Example - 'time series design [EFO-0001779]'Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified STRING ManifestColumn ManifestColumn
extractionMethod The name of the process used to separate a desired component of an input material from the remainder. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified STRING ManifestColumn ManifestColumn
fieldCenterCode Name of the field center STRING ManifestColumn ManifestColumn
fileFormat Defined format of the data file, typically corresponding to extension, but sometimes indicating more general group of files produced by the same tool or software FASTQ, FASTA, SAM, BAM, CRAM, VCF, BCF, GTF, GFF, GFF3, BED, BigBed, WIG, BigWig, CSV, TSV, MTX, H5AD, LOOM, RDS,PED, MAP, BED_PLINK, TPED, TFAM, BEDGRAPH, NARROWPEAK, BROADPEAK, TAGALIGN, OME-TIFF, ND2, CZI, LSM, H5, HDF5, PARQUET, PDB, MMCIF, JSON, YAML, XML, TXT, XLSX, CSV, Not assigned STRING ManifestColumn ManifestColumn
fractionIdentifier Number of fractions in the experimental runProvide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified STRING ManifestColumn ManifestColumn
gasFlowTemperature e.g., nebulization gas, cone gas, etc.Unit of measure-C, F, K, Not specified NUMBER ManifestColumn ManifestColumn
gasFlowTemperatureUnit Unit of gas flow temperature C,F,K STRING ManifestColumn ManifestColumn
genotypeTechnology Method(s) used to genotype variants in the discovery stage. Separate multiple methods separated by a semicolon (;). Example - genome-wide genotyping array, exome-wide sequencing, targeted genotyping array STRING ManifestColumn ManifestColumn
hasAssayControl Boolean flag indicating whether or not a specimen is a technical or assay control. Examples include study pools or reference pools, blanks, or internal standards. BOOLEAN ManifestColumn ManifestColumn
hasIonizationSource Were the ionization conditions recorded to enable reproduction of the experiment? No,Yes BOOLEAN ManifestColumn ManifestColumn
imputation Were SNPs imputed for the discovery GWAS? STRING ManifestColumn ManifestColumn
imputationPanel Panel used for imputation. Example - 1000 Genomes Phase 3 STRING ManifestColumn ManifestColumn
imputationSoftware Imputation software. Example - IMPUTE STRING ManifestColumn ManifestColumn
instrumentModel The model of the instrument used. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified STRING ManifestColumn ManifestColumn
ionProperty Ion charge state (positive or negative-ion analysis) Negative,Positive STRING ManifestColumn ManifestColumn
isobaricLabelingReagent Reagent set used for isobaric labeling. Examples- iTRAQ113 TMT126Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified STRING ManifestColumn ManifestColumn
labelFreeQuantitation Type of label-free data analysis strategyProvide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified Label-free gene level quantitation,Label-free peptide level quantitation,Label-free protein group level quantitation,Label-free protein level quantitation,Label-free raw feature quantitation,Not applicable,Not available,Not collected,Not specified,Unknown STRING ManifestColumn ManifestColumn
labelQuantitation Type of labeling usedProvide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified AminoxyTMT,DiART,DiLeu,Glyco-TMT,Hydrazide TMT,IodoTMT,IPTL,iTRAQ,iTRAQH,Label Free,Not available,Not collected,Not specified,TMT,Unknown STRING ManifestColumn ManifestColumn
lensVoltages The skimmer/focusing lens voltages e.g., capillary voltage, etc. NUMBER ManifestColumn ManifestColumn
lensVoltagesUnit Unit of lens voltages STRING ManifestColumn ManifestColumn
libLayout Library layout. Specify whether to expect single, paired, or other configurations of reads. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified STRING ManifestColumn ManifestColumn
libReadsSeqd Library reads sequenced. Total number of clones sequenced from the library. Example - '20'Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified INTEGER ManifestColumn ManifestColumn
libSize Library size. Total number of clones in the library prepared for the project. Example - '50'Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified INTEGER ManifestColumn ManifestColumn
libVector Library vector. Cloning vector type(s) used in the construction of libraries. Example - 'Bacteriophage P1'Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified STRING ManifestColumn ManifestColumn
libraryBatchID Library batch identifier, provided by the data contributor to Sage Bionetworks. The batch identifier(s) must be stored in a data dictionary .csv file uploaded to Synapse. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified STRING ManifestColumn ManifestColumn
lifeStage The life stage of the individual.note- Other values are possible depending on life stage terminology for individual species. Please let the data curation team know. Adult,Juvenile,Post-Juvenile, Not applicable, Not collected, Not specified, Other, Unknown STRING ManifestColumn ManifestColumn
measurementTechnique The name of the measurement technique describing the assay method. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified Bisulfite sequencing,Clinical data,Genome-wide association study,High-performance liquid chromatography tandem mass spectrometry,Liquid chromatography mass spectrometry,Liquid chromatography tandem mass spectrometry,Mass spectrometry,Metabolomics,MetaX-processed metabolomics data,Proximity extension assay,RNA sequencing,Single-cell RNA sequencing,Shotgun metagenomic sequencing,Single nucleotide polymorphism array,Tandem Mass Tag proteomics,Whole-genome sequencing,Unknown,Other,Not collected,Not applicable,Not specified STRING ManifestColumn ManifestColumn
mid Multiplex identifiers. Molecular barcodes, called Multiplex Identifiers (MIDs), are used to tag unique samples in a sequencing run specifically. Sequence should be reported in uppercase letters. Example - 'GTGAATAT'Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified STRING ManifestColumn ManifestColumn
modificationParameters Modification parameters for a search engine run. (ex. PSI- PI http-//www.w3.org/2002/07/owl#Axiom) or used in the peptide identification database search. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified STRING ManifestColumn ManifestColumn
msAnalyteType The type of biospecimen subjected to analysis (ex., peptide, protein, metabolite, lipid)Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified STRING ManifestColumn ManifestColumn
msAssayTechnique Specified the mass spectrometer technique used or the name of the proteomics assay used (ex. DDA)Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified STRING ManifestColumn ManifestColumn
msTarget Specifies whether or not a specific molecule(s) is/are targeted for detection/measurement by the assay Not applicable,Not available,Not collected,Not specified,Targeted,Unknown,Untargeted STRING ManifestColumn ManifestColumn
nucleAcidExt Nucleic acid extraction. A link to a literature reference, electronic resource or a standard operating procedure (SOP), that describes the material separation to recover the nucleic acid fraction from a sample. (example, https-//mobio.com/media/wysiwyg/pdfs/protocols/12888.pdf). Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified STRING ManifestColumn ManifestColumn
numberContig Number of contigs. Total number of contigs in the cleaned/submitted assembly that comprise a given genome, SAG, MAG, or UViG. Example - '40'Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified INTEGER ManifestColumn ManifestColumn
numberIndividuals Number of individuals in a group. Example - 2000 INTEGER ManifestColumn ManifestColumn
processingBatchID Processing batch identifier, provided by the data contributor to Sage Bionetworks. The batch identifier(s) must be stored in a data dictionary .csv file uploaded to Synapse STRING ManifestColumn ManifestColumn
program ELITE,AD STRING ManifestColumn ManifestColumn
projectShortName LC,ILO,LLFS,LG, Not assigned STRING ManifestColumn ManifestColumn
quantationStrategy The general strategy used for differential analysis Example - Absolute quantitation analysis, Isobaric label quantitation analysis, LC-MS label-free quantitation analysis,Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified STRING ManifestColumn ManifestColumn
readLengthUnits The units of measurement. Provide a value or Unknown Not collected Not applicable Not specified STRING ManifestColumn ManifestColumn
readmeFile The name of any readme file uploaded to Synapse. Example - example.tsv STRING ManifestColumn ManifestColumn
reagentCatalogNumber If the assay reagent is a commercial product, enter the vendor's catalog identifier. If the reagent is a custom preparation enter 'NA'. STRING ManifestColumn ManifestColumn
reagentContact The contact information is particularly helpful when the reagent is not from a commercial vendor. STRING ManifestColumn ManifestColumn
reagentIDs One or more identifiers, separated by a semicolon (;). The reagent identifier(s) must be stored in a data dictionary .csv file uploaded to Synapse. STRING ManifestColumn ManifestColumn
reagentLotNumber The lot number is often provided by a reagent source when the reagent is replenished over time. STRING ManifestColumn ManifestColumn
reagentManufacturer The manufacturer is the source of a reagent and may include commercial vendors as well as non-commercial sources (e.g., collaborating labs). STRING ManifestColumn ManifestColumn
reagentName The reagent name is an alternative to the Reagent ID. STRING ManifestColumn ManifestColumn
reagentWeblink An internet address that may provide details of an assay reagent. STRING ManifestColumn ManifestColumn
referenceTranscriptID The ID for the transcript/gene. Either the NCBI ID or the Ensembl ID must be provided. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified STRING ManifestColumn ManifestColumn
reportedTrait The trait under investigation. Please describe the trait concisely but with enough detail to be clear to a non-specialist. Avoid the use of abbreviations; if these are necessary, please define them or their source in the readme file. Example - Reticulocyte count STRING ManifestColumn ManifestColumn
repositoryName The public repository name for the transcript (for example, Ensembl or NCBI Gene) ArrayExpress,Broad Single Cell Portal,dbGAP,ENA,Ensembl,FlowRepository,GenBank,GENCODEv38,GRCh38,GEO,GISAID,IEDB,ImmPort,MassIVE,MetaboLights,Metabolomics Workbench,MGnify,NCBI Gene,PRIDE,SRA,Synapse,UniProt,Other,Unknown,Not collected,Not applicable,Not specified STRING ManifestColumn ManifestColumn
resourceType The type of resource being stored and annotated experimentalData,metadata,tool,analysis,computationalNotebook,softwareTool,Not assigned STRING ManifestColumn ManifestColumn
resultUnit The unit for the result value FPKM,raw count, Not applicable,Not collected,Not specified,RPKM,TPM,Unknown STRING ManifestColumn ManifestColumn
rnaBatchID Isolation batch identifier, provided by the data contributor to Sage Bionetworks. The batch identifier(s) must be stored in a data dictionary .csv file uploaded to Synapse. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified STRING ManifestColumn ManifestColumn
rnaBatchSize The number of samples NUMBER ManifestColumn ManifestColumn
rnaBatchSizeUnit The unit of measurement for number of samples in a batch AFU,AI,AU/ml,bp g/dl,DK units/ml,g/l,gm,HAU,IU,iu/l,IU/ml,Kallikrein Inactivator Unit per Milliliter,kg,l,M,mg,mg/dl,mg/l,mg/ml,miu/ml,ml,mM,MOI,ng,ng/dl,ng/ml,ng/nl,ng/ul,nl,nM,Not specified,NPX,optical density,other,PFU,PFUe,pg,pg/mg creatinine,pg/ml,pg/nl,pg/ul,pl,pM,Pound,TCID50,ug,ug/dl,ug/l,ug/ml,ug/ul,uiu/ml,ul,uM,umol/l,units/ml STRING ManifestColumn ManifestColumn
sampleBatchID Sample batch lot identifier, provided by the data contributor to Sage Bionetworks. The batch identifier(s) must be stored in a data dictionary .csv file uploaded to Synapse STRING ManifestColumn ManifestColumn
sampleIntroduction The sample introduction and delivery. From GC, from LC, direct infusion without chromatography, direct infusion using dedicated autosampler flow rate. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified STRING ManifestColumn ManifestColumn
samplePrepProtocol An internet address that may provide more details of the protocol information (web link). Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified STRING ManifestColumn ManifestColumn
sampleType The type of sample collected or the term used to describe the source of a biospecimen used for a laboratory test. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified STRING ManifestColumn ManifestColumn
seqMethod Sequencing method. Sequencing method used; Example - 'Sanger, pyrosequencing, ABI-solid'. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified STRING ManifestColumn ManifestColumn
seqPlatform Sequencing platform information. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified STRING ManifestColumn ManifestColumn
sequencingBatchID Sequencing batch identifier, provided by the data contributor to Sage Bionetworks. The batch identifier(s) must be stored in a data dictionary .csv file uploaded to Synapse. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified STRING ManifestColumn ManifestColumn
sequencingBatchSize The number of samples. Provide a value or Unknown Not collected Not applicable Not specified STRING ManifestColumn ManifestColumn
sequencingBatchSizeUnit The unit of measurement for number of samples in a batch. Provide a value or Unknown Not collected Not applicable Not specified STRING ManifestColumn ManifestColumn
sop Relevant standard operating procedures. Standard operating procedures used in the assembly and/or annotation of genomes, metagenomes, or environmental sequences. Example - 'http-//press.igsb.anl.gov/earthmicrobiome/protocols-and-standards/its/)'Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified STRING ManifestColumn ManifestColumn
sourceMatID Source material identifiers. A unique identifier assigned to a material sample (as defined by http-//rs.tdwg.org/dwc/terms/materialSampleID and as opposed to a particular digital record of a material sample) used for extracting nucleic acids, and subsequent sequencing.The identifier can refer to the original material collected or any derived sub-samples. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified STRING ManifestColumn ManifestColumn
speciesAge Age of individual (formatted in months, ex. "72 months").note- Uncertainty about the age might require recording age by specifying a lower and upper estimate in months for the age of the animal. STRING ManifestColumn ManifestColumn
speciesGroup The taxonomic ranking including both species and subspecies the individual belongs to. Amphibian,Bird,Fish,Invertebrate,Mammal,Not applicable,Not collected,Not specified,Reptile,Unknown STRING ManifestColumn ManifestColumn
speciesName The scientific name of the species (typically a taxonomic group, ex. "Eremophila alpestris) the individual belongs to.""" Acomys cahirinus, Acomys russatus, Accipiter cooperii, Actitis macularius, Aix sponsa, Anas acuta, Anas carolinensis, Anas platyrhynchos, Antigone canadensis, Archilochus colubris, Artibeus jamaicensis, Baeolophus bicolor, Balaena mysticetus, Blarina brevicauda, Bombycilla cedrorum, Bonasa umbellus, Bos taurus, Branta canadensis, Bubo virginianus, Buteo jamaicensis, Buteo lineatus, Canis latrans, Cardinalis cardinalis, Castor canadensis, Cavia porcellus, Charadrius vociferus, Chinchilla lanigera, Columba livia, Condylura cristata, Corvus brachyrhynchos, Cricetomys ansorgei, Cricetulus barabensis, Cricetulus griseus, Cryptomys damarensis, Cuniculus paca, Cyanocitta cristata, Cygnus olor, Dryobates pubescens, Dumetella carolinensis, Ellobius lutescens, Ellobius talpinus, Eonycteris spelaea, Eptesicus fuscus, Equus caballus, Eremophila alpestris, Fukomys damarensis, Haemorhous mexicanus, Heterocephalus glaber, Hirundo rustica, Homo sapiens, Hydrochoerus hydrochaeris, Hydroprogne caspia, Hylocichla mustelina, Icteria virens, Larus argentatus, Larus delawarensis, Macaca fascicularis, Macaca mulatta, Mareca strepera, Marmota monax, Melanerpes carolinus, Meleagris gallopavo, Melospiza melodia, Meriones unguiculatus, Mesocricetus auratus, Microtus pennsylvanicus, Mimus polyglottos, Molothrus ater, Multi-species, Mus musculus, Myocastor coypus, Myotis lucifugus, Nannospalax galili, Neosciurus carolinensis, Neotoma cinerea, Neotoma floridana, Not applicable, Not collected, Not provided, Not specified, Octodon degus, Odocoileus virginianus, Ondatra zibethicus, Other, Pan troglodytes, Papio anubis, Passer domesticus, Passerina caerulea, Passerina cyanea, Peromyscus gossypinus, Peromyscus leucopus, Peromyscus maniculatus, Phalacrocorax auritus, Phasianus colchicus, Picoides villosus, Pipilo erythrophthalmus, Poecile carolinensis, Quiscalus quiscula, Rattus norvegicus, Rattus rattus, Regulus calendula, Saimiri boliviensis, Sayornis phoebe, Scalopus aquaticus, Sciurus carolinensis, Sciurus niger, Sciurus vulgaris, Scolopax minor, Setophaga citrina, Setophaga coronata, Setophaga dominica, Setophaga petechia, Setophaga pinus, Sialia sialis, Sigmodon hispidus, Sitta carolinensis, Spatula clypeata, Spinus tristis, Spizella passerina, Spizella pusilla, Spizelloides arborea, Struthio camelus, Sturnus vulgaris, Sus scrofa, Sylvilagus floridanus, Tachycineta bicolor, Tamias striatus, Tamiasciurus hudsonicus, Thryothorus ludovicianus, Toxostoma rufum, Troglodytes aedon, Turdus migratorius, Tursiops truncatus, Vicugna pacos, Vireo griseus, Vireo olivaceus, Zalophus californianus, Zenaida macroura, Zonotrichia albicollis, Unknown STRING ManifestColumn ManifestColumn
specimenAge The subject's age at the time of specimen extraction is the individual's age (since birth) at the time a given specimen was extracted. Measured as age in years. Other, Unknown, Not collected, Not applicable STRING ManifestColumn ManifestColumn
specimenSource Indicate the biological area of the specimen human, wild, captive, not applicable, not collected, other, unknown STRING ManifestColumn ManifestColumn
specimenType Type of biological material sample taken from a biological entity for research purposes blood, brain, buffy coat, cell line, cells, nervous system, organoid, plasma, saliva, serum, skin, stool, tissue, urine, Not applicable, Not collected, Not specified, Other, Unknown STRING_LIST ManifestColumn ManifestColumn
stage Stage of the experimental design. Discovery,Not applicable,Not collected,Not specified,Other,Replication,Unknown STRING ManifestColumn ManifestColumn
statisticalModel A brief description of the statistical model used to determine association significance. It is important to distinguish studies that would otherwise appear identical (e.g., the same trait analyzed using additive, dominant, and recessive models). Example - additive model STRING ManifestColumn ManifestColumn
studyCode Unique identifier for the study, assigned by the DCC CDCP,ILO,LC,LG,LLFS,Other STRING ManifestColumn ManifestColumn
studyKey The short acronym for a study name in a URL-friendly format (ex. LLFS_Metabolomics OR ELPSCRNA) STRING ManifestColumn ManifestColumn
summaryFile The name of any summary statistics file uploaded to Synapse. Example - example.tsv STRING ManifestColumn ManifestColumn
summaryStatisticsAssembly Genome assembly for the summary statistics. Example - GRCh38 STRING ManifestColumn ManifestColumn
targetGene Targeted gene or locus name for marker gene studies. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified STRING ManifestColumn ManifestColumn
taxon Taxonomic identifier. The National Center for Biotechnology Information taxon ID (formatted as, ex. "txid9989") STRING ManifestColumn ManifestColumn
technologyPlatformVersion The specific version (application, manufacturer, model, lab, etc.) of a technology that is used to carry out a laboratory or computational experiment. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified STRING ManifestColumn ManifestColumn
tissueVolume The volume of the tissue sample. Measured in microliters. STRING ManifestColumn ManifestColumn
transcriptType The type of transcript reported lincRNA,mRNA,total RNA minus rRNA,Not applicable,Not collected,Not specified,Other,snRNA,Unknown STRING ManifestColumn ManifestColumn
treatmentAmountUnit Unit of treatment amount. AFU,AI,AU/ml,DK units/ml,g/dl,g/l,gm,HAU,IU,iu/l,IU/ml,Kallikrein Inactivator Unit per Milliliter,kg,l,M,mg,mg/dl,mg/l,mg/ml,miu/ml,ml,mM,MOI,ng,ng/dl,ng/ml,ng/nl,ng/ul,nl,nM,Not specified,NPX,optical density,other,PFU,PFUe,pg,pg/mg creatinine,pg/ml,pg/nl,pg/ul,pl,pM,Pound,TCID50,ug,ug/dl,ug/l,ug/ml,ug/ul,uiu/ml,ul,uM,umol/l,units/ml NUMBER ManifestColumn ManifestColumn
treatmentAmountValue The Amount Value indicates how much (concentration, mass, volume) of a treatment agent was applied to a sample. STRING ManifestColumn ManifestColumn
treatmentDurationUnit Unit of treatment duration. d.p.c.,Days,Hours,Minutes,Months,Not applicable,Not collected,Not specified,Seconds,Unknown,Weeks,Years STRING ManifestColumn ManifestColumn
treatmentDurationValue Duration of treatment. NUMBER ManifestColumn ManifestColumn
treatmentIDs One or more identifiers, separated by a semicolon (;). The treatment identifier(s) must be stored in a data dictionary .csv file uploaded to Synapse. STRING ManifestColumn ManifestColumn
treatmentName Treatments refer to in vitro modifications of samples. Three treatment types are supported- agent amount, duration, and temperature. The treatment name is an alternate identifier to the Treatment ID. STRING ManifestColumn ManifestColumn
treatmentTemperatureUnit Unit of treatment temperature. C,F,K,Not specified STRING ManifestColumn ManifestColumn
treatmentTemperatureValue Value of treatment temperature. NUMBER ManifestColumn ManifestColumn
useReadMeFile Was a readme file uploaded to Synapse? STRING ManifestColumn ManifestColumn
useReagent Was a reagent applied to the sample? FALSE,TRUE BOOLEAN ManifestColumn ManifestColumn
useSummaryFile Was a summary statitics file uploded to Synapse? STRING ManifestColumn ManifestColumn
useTreatment Was a treatment applied to the sample? BOOLEAN ManifestColumn ManifestColumn
vacuumPressure The recorded vacuum pressure value NUMBER ManifestColumn ManifestColumn
vacuumPressureUnit Unit of vacuum pressure value AFU,AI,AU/ml,bp g/dl,DK units/ml,g/l,gm,HAU,IU,iu/l,IU/ml,Kallikrein Inactivator Unit per Milliliter,kg,l,M,mg,mg/dl,mg/l,mg/ml,miu/ml,ml,mM,MOI,ng,ng/dl,ng/ml,ng/nl,ng/ul,nl,nM,Not specified,NPX,optical density,PFU,PFUe,pg,pg/mg creatinine,pg/ml,pg/nl,pg/ul,pl,pM,Pound,TCID50,ug,ug/dl,ug/l,ug/ml,ug/ul,uiu/ml,ul,uM,umol/l,units/ml STRING ManifestColumn ManifestColumn
valueReported The count or gene count for the transcript STRING ManifestColumn ManifestColumn
variantCount The number of variants analysed in the discovery stage (after QC). Example - 52500 STRING ManifestColumn ManifestColumn
visitCode Indicate which longitudinal visit for the individual the data comes from, provided by the data contributor's data dictionary NUMBER ManifestColumn ManifestColumn

Table of contents