ManifestColumn
module in the data model
| Key | Key Description | Valid Values | columnType | Parent | module |
|---|---|---|---|---|---|
| DNAextraction | DNA extraction kit method. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | STRING | ManifestColumn | ManifestColumn | |
| acquisitionBatchID | Acquisition batch identifier, provided by the data contributor to Sage Bionetworks. The batch identifier(s) must be stored in a data dictionary .csv file uploaded to Synapse | STRING | ManifestColumn | ManifestColumn | |
| acquisitionBatchSize | The number of samples | STRING | ManifestColumn | ManifestColumn | |
| acquisitionBatchSizeUnit | The unit of measurement for number of samples in a batch | STRING | ManifestColumn | ManifestColumn | |
| acquisitionMode | The specific aspect of a mass spectrometer method by which mass ranges are selected and possibly dissociated (full scan, MSn, SIM, MRM, etc.). Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | STRING | ManifestColumn | ManifestColumn | |
| acquisitionSoftware | The name of the acquisition software used. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | STRING | ManifestColumn | ManifestColumn | |
| acquisitionSoftwareVersion | The version number of software used. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | NUMBER | ManifestColumn | ManifestColumn | |
| adapters | Adapters provide priming sequences for both amplification and sequencing of the sample-library fragments. Both adapters should be reported; in uppercase letters. Example - 'AATGATACGGCGACCACCGAGATCTACACGCT; CAAGCAGAAGACGGCATACGAGAT'Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | STRING | ManifestColumn | ManifestColumn | |
| adjustedCovariates | Any covariates the GWAS is adjusted for. Multiple values can be listed separately by a semicolon (;). Example - age;sex | STRING | ManifestColumn | ManifestColumn | |
| analysisType | Type of analysis | ANOVA,batch effect correction,clustering,data normalization,de-novo assembly,dose response study,enrichment analysis,genome-wide association,mendelian randomization analysis,network analysis,polygenic risk scores, Not assigned | STRING | ManifestColumn | ManifestColumn |
| arrayInformation | Additional information about the genotyping array. For example, for targeted arrays, please provide the specific type of array. Example - Immunochip | STRING | ManifestColumn | ManifestColumn | |
| arrayManufacturer | Manufacturer of the genotyping array used for the discovery stage. Separate multiple manufacturers by a semicolon (;). Example - Illumina, Affymetrix, Perlegen | STRING | ManifestColumn | ManifestColumn | |
| assemblyName | Name/version of the assembly provided by the submitter used in the genome browsers and the community. Example - 'HuRef, JCVI_ISG_3_1.0'Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | STRING | ManifestColumn | ManifestColumn | |
| assemblyQual | Assembly quality. The assembly quality category is based on sets of criteria outlined for each assembly quality category.High Quality- Multiple fragments where gaps span repetitive regions. Presence of the 23S, 16S and 5S rRNA genes and at least 18 tRNAs.Medium Quality- Many fragments with little to no review of assembly other than reporting of standard assembly statistics.Low Quality- Many fragments with little to no review of assembly other than reporting of standard assembly statistics. Assembly statistics include, but are not limited to, total assembly size, number of contigs, contig N50/L50, and maximum contig length. Example values - high-quality genome, medium-quality genome, low-quality genome | STRING | ManifestColumn | ManifestColumn | |
| assemblySoftware | Tool(s) used for assembly, including version number and parameters. Example - 'metaSPAdes;3.11.0; kmer set 21,33,55,77,99,121, default parameters otherwise'. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | STRING | ManifestColumn | ManifestColumn | |
| associatedResource | Relevant electronic resources. A related resource that is referenced, cited, or otherwise associated to the sequence. Example - 'http-//www.earthmicrobiome.org/'Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | STRING | ManifestColumn | ManifestColumn | |
| backgroundTrait | Any background trait(s) shared by all individuals in the GWAS (e.g. in both cases and controls). Example - Nicotine dependence | STRING | ManifestColumn | ManifestColumn | |
| batchID | ID used to identify a batch, provided by the data contributor to Sage Bionetworks. The batch identifier(s) must be stored in a data dictionary .csv file uploaded to Synapse | STRING | ManifestColumn | ManifestColumn | |
| batchLabel | Used to supply batch label information with any string value | STRING | ManifestColumn | ManifestColumn | |
| captivityDuration | The duration of captivity in months for the individuals in captivity (formatted in months, ex. 72 months).note- Applicable only to animals with captivity status captive. | STRING | ManifestColumn | ManifestColumn | |
| captivityStatus | The status of the individual with regard to captivity.note- Wild, captive, and stranded values are applicable, especially for marine mammals. Depending on life stage terminology for individual species, other values are possible. Please let the data curation team know. | Captive,Stranded,Wild, Not applicable, Not collected, Not specified, Other, Unknown | STRING | ManifestColumn | ManifestColumn |
| commonName | The biological species common name the individual belongs to (ex. "Horned Lark"). note- As a default, the valid scientific name for the species should be indicated. | abyssinian ground hornbill, adriatic sturgeon, aeolian wall lizard, african grass rat, alpaca, alvarez's mastiff bat, amazonian toadfish, american alligator, american beaver, american crow, american flamingo, american goldfinch, american mink, american red squirrel, american robin, american shad, american tree sparrow, american woodcock, anna's hummingbird, antarctic jonasfish, antarctic lanternfish, antarctic spiny plunderfish, argentine brown bat, asian arowana, asian elephant, atlantic cod, atlantic hagfish, atlantic halibut, atlantic horse mackerel, atlantic stingray, atlantic white-sided dolphin, ballan wrasse, banded archerfish, banded killifish, bank vole, barbel, barn swallow, barnacle goose, barred grass snake, basking shark, bearded vulture, big brown bat, black goby, black mastiff bat, black rat, black rhinoceros, black-headed gull, black-legged kittiwake, blainville's beaked whale, blue catfish, blue grosbeak, blue jay, blue whale, blue whiting, blue-and-yellow macaw, blunt-snouted clingfish, bocage's wall lizard, boeseman's rainbowfish, bolivian squirrel monkey, bolson tortoise, bowhead whale, brauer's lanternfish, brown long-eared bat, brown rat, brown thrasher, brown trout, brown-headed cowbird, budgerigar, bushy-tailed woodrat, butterfly blenny, cairo spiny mouse, california sea lion, canada goose, canada lynx, cape hairy bat, capybara, carolina chickadee, carolina wren, caspian tern, catalonian wall lizard, cattle, cave nectar bat, cedar waxwing, channel bull blenny, chimpanzee, chinese hamster, chinese pangolin, chipping sparrow, chiriquinan serotine, chub mackerel, climbing perch, clouded leopard, coastal tailed frog, common big-eared bat, common bottlenose dolphin, common bream, common brushtail possum, common buzzard, common chaffinch, common crane, common cuckoo, common dab, common dace, common degu, common dolphin, common frog, common goldeneye, common grackle, common gull, common kestrel, common marmoset, common minke whale, common moorhen, common myna, common ostrich, common pipistrelle, common pochard, common rudd, common shrew, common starfish, common starling, common swift, common tern, common toad, common wall lizard, common whitefish, common wood pigeon, common yellowthroat, convict blenny, Cooper's hawk, copperband butterflyfish, corbin's sand eel, cory's shearwater, cotton mouse, coyote, coypu, crab-eating macaque, cretan wall lizard, crucian carp, cuckoo wrasse, cunner, curacao myotis, dalmatian pelican, dalmatian wall lizard, damaraland mole-rat, daubenton's bat, davis's round-eared bat, delta smelt, denticle herring, diamondback terrapin, double-crested cormorant, downy woodpecker, eastern bluebird, eastern chipmunk, eastern cottontail, eastern gray squirrel, eastern happy, eastern mole, eastern narrow-mouthed toad, eastern phoebe, eastern towhee, eastern woodrat, egyptian fruit bat, egyptian goose, electric eel, electron subantarctic lanternfish, epaulette shark, etruscan shrew, eurasian blackcap, eurasian blue tit, eurasian coot, eurasian curlew, eurasian minnow, eurasian otter, eurasian oystercatcher, eurasian red squirrel, eurasian sparrowhawk, eurasian spoonbill, eurasian teal, european badger, european conger, european eel, european fire-bellied toad, european flounder, european golden plover, european hedgehog, european herring gull, european lancelet, european leaf-toed gecko, european nightjar, european pied flycatcher, european pine marten, european plaice, european pond turtle, european rabbit, european river lamprey, european robin, european sea squirt, european shag, european smelt, european snow vole, european turtle dove, european water vole, false killer whale, field sparrow, fin whale, fivebeard rockling, flier cichlid, florida worm lizard, fox squirrel, french guiana freshwater stingray, freshwater garfish, gaboon caecilian, gadwall, galili blind mole-rat, garden warbler, gelatinous eelpout, geoffroy's bat, giant-fin mudskipper, gilthead seabream, glaucous-winged gull, golden eagle, golden hamster, golden spiny mouse, goode's thornscrub tortoise, gray catbird, gray short-tailed opossum, gray whale, gray wolf, great black-backed gull, great bustard, great cormorant, great evening bat, great fruit-eating bat, great horned owl, great potoo, great white shark, greater argentine, greater horseshoe bat, greater mouse-eared bat, greater pipefish, greater scaup, greater white-fronted goose, green sea turtle, green-winged teal, grey crowned crane, grey gurnard, grey seal, greylag goose, groundhog, gudgeon, guinea pig, gyrfalcon, hairy woodpecker, hairy-legged myotis, hairy-nosed bat, harbour porpoise, harpy eagle, harvest mouse, hawaiian crow, hawksbill sea turtle, hazel dormouse, heller's broad-nosed bat, highfin lizardfish, hispid cotton rat, honeycomb rockfish, hooded warbler, horned lark, horse, hourglass treefrog, house finch, house mouse, house sparrow, house wren, human, humboldt penguin, ibiza wall lizard, indian glassy fish, indigo bunting, indo-pacific tarpon, intermediate fruit-eating bat, intermediate roundleaf bat, italian wall lizard, jamaican fruit bat, japanese pufferfish, jewelled blenny, john dory, kagu, kakapo, kemp's ridley sea turtle, killdeer, kuhl's pipistrelle, lance-tailed manakin, lanner falcon, lanternfish, large-eye snaggletooth, largescale foureyes, lataste's viper, least weasel, leatherback sea turtle, leisler's bat, lemon sole, lesser black-backed gull, lesser egyptian jerboa, lesser kestrel, lesser rhea, lesser sand eel, lesser weever, lesser white-fronted goose, light-bulb sea squirt, linnaeus's two-toed sloth, little brown bat, little owl, live sharksucker, loggerhead sea turtle, long-finned pilot whale, long-tailed chinchilla, long-tailed duck, long-tailed tit, longfin smelt, longspined bullhead, lowland paca, lumpfish, maguari stork, mallard, maltese wall lizard, marbled rockcod, masked duck, mauritius kestrel, meadow vole, merriam's long-tongued bat, milkfish, minispotted lanternsfish, mongolian gerbil, monito del monte, mourning dove, Multi-species, muskrat, mute swan, naked mole-rat, nathusius's pipistrelle, natterer's bat, nelson's sparrow, new caledonian crow, nine-banded armadillo, north american deermouse, north american porcupine, north atlantic right whale, northern bat, northern bottlenose whale, northern cardinal, northern carmine bee-eater, northern goshawk, northern mockingbird, northern mole vole, northern pike, northern pintail, northern short-tailed shrew, northern shoveler, Not applicable, Not collected, Not provided, Not specified, olive baboon, olive python, orange-tipped sea squirt, orbiculate cardinalfish, Other, painted frog, pale spear-nosed bat, pallas's mastiff bat, palmate newt, parti-coloured bat, pearleye, pencil smelt, peregrine falcon, philippine flying lemur, pine warbler, pinecone soldierfish, pink pigeon, pink-footed goose, plains spadefoot toad, platypus, plumbeous ibis, pollack, pool frog, pygmy fruit-eating bat, rainbow smelt, rakery beaconlamp, razorbill, red bandfish, red deer, red gurnard, red junglefowl, red kite, red porgy, red-bellied piranha, red-bellied woodpecker, red-billed tropicbird, red-breasted merganser, red-crested pochard, red-crested turaco, red-eyed vireo, red-fronted tinkerbird, red-legged seriema, red-shouldered hawk, red-tailed hawk, red-throated loon, reedfish, reeves's muntjac, rhesus macaque, rifleman, riggenbach's reed frog, ring-billed gull, ring-necked pheasant, ring-tailed lemur, risso's dolphin, rock gunnel, rock pigeon, rough lanternfish, royal ground snake, ruby-crowned kinglet, ruby-throated hummingbird, ruffed grouse, rufous frog, saker falcon, saltmarsh sparrow, sand lizard, sandhill crane, savannah sparrow, schreibers's bent-winged bat, sea lamprey, sei whale, seychelles magpie-robin, shanny, short-beaked echidna, skyros wall lizard, small-spotted catshark, smalltooth sawfish, smew, smooth newt, snow crab, solenette, song sparrow, soprano pipistrelle, south island takahe, southern bluefin tuna, southern corroboree frog, southern giant pouched rat, southern tamandua, sowell's short-tailed bat, sowerby's beaked whale, speckled mousebird, spotted sandpiper, spotted scat, spotty, star-nosed mole, starry smooth-hound, sterlet, stoat, stone loach, stoplight loosejaw, striped aplochiton, striped catfish, striped dwarf hamster, sunda slow loris, surucua trogon, swainson's thrush, swamp sparrow, swift parrot, taiga bean goose, tammar wallaby, tawny frogmouth, tawny owl, thickback sole, thicklip grey mullet, thorny skate, three-bearded rockling, three-spined stickleback, tiny cayenne caecilian, trahira, transcaucasian mole vole, tree swallow, true's beaked whale, trumpet flake-ascidian, tub gurnard, tufted duck, tufted titmouse, tundra swan, tunicate, two-lined caecilian, two-spotted clingfish, tyrrhenian wall lizard, Unknown, vaquita, vaucher's wall lizard, village indigobird, warty frogfish, western gull, western jackdaw, western terrestrial garter snake, whiskered bat, whiskered treeswift, white-beaked dolphin, white-breasted nuthatch, white-eyed vireo, white-faced whistling duck, white-footed mouse, white-tailed deer, white-tailed eagle, white-throated dipper, white-throated sparrow, whooper swan, whooping crane, wild boar, wild turkey, wood duck, wood mouse, wood thrush, yellow warbler, yellow-bellied toad, yellow-breasted chat, yellow-legged gull, yellow-rumped warbler, yellow-spotted rock hyrax, yellow-throated sandgrouse, yellow-throated warbler, yellowfin tuna, zebra finch, zebrafish, zig-zag eel | STRING | ManifestColumn | ManifestColumn |
| consentGroupID | Indicate the consent group for the individual, provided by the data contributor's data dictionary | STRING | ManifestColumn | ManifestColumn | |
| consortium | The name of the consortium | ELITE, ELITE CDCP, Not assigned | STRING | ManifestColumn | ManifestColumn |
| conversionRatio | The ratio or % detailing how well the bisulfite conversion worked. Provide a value or Unknown Not collected Not applicable Not specified | STRING | ManifestColumn | ManifestColumn | |
| conversionRatioUnits | The units of measurement. Provide a value or Unknown Not collected Not applicable Not specified | STRING | ManifestColumn | ManifestColumn | |
| countryCode | Indicate the geographic region for the individual (shown as ex. "840") | INTEGER | ManifestColumn | ManifestColumn | |
| dataFile | Name of additional file(s) accompanying the data. The file(s) provide, for example, the name of any raw files generated by the instrument, generated reports from a vendor, an Rscript, or an instructions document. The files can be instrument raw files, converted peak lists such as mzML, MGF, or result files like mzIdentML. The files can be additional documentation submitted alongside the data needed for reuse and sharing purposes. Provide the file names of any additional files submitted alongside the data (ex., an ADAT file). Multiple file names can be separated by (;)Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | STRING | ManifestColumn | ManifestColumn | |
| dataModelVersion | Version of the data model | STRING | ManifestColumn | ||
| dataSubtype | Further qualification of dataType, which may be used to indicate the state of processing of the data, aggregation of the data, or presence of metadata | raw,processed,results,normalized,metadata, Not assigned | STRING | ManifestColumn | ManifestColumn |
| dataType | The category or format of data generated or collected in an experiment, describing the kind of information the dataset contains (for example, genomics, imaging, proteomics, or behavioral data). | clinical,drugScreen,electrophysiology,epigenetics,geneExpression,genomeAssembly,genomicVariants,imaging,lipidomics,metabolomics,metagenomics,Not applicable,Not collected,Not specified,Other,phenotype,proteomics,Unknown,wearableData | STRING_LIST | ManifestColumn | ManifestColumn |
| dataTypeAll | clinical,drugScreen,electrophysiology,epigenetics,geneExpression,genomeAssembly,genomicVariants,imaging,lipidomics,metabolomics,metagenomics,Not applicable,Not collected,Not specified,Other,phenotype,proteomics,Unknown,wearableData | STRING | ManifestColumn | ManifestColumn | |
| databaseLibrary | The name(s) of the associated database library. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | STRING | ManifestColumn | ManifestColumn | |
| databaseName | The name of the search database (nr, SwissProt or est_human, and/or mass spectral library). Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | STRING | ManifestColumn | ManifestColumn | |
| databaseSource | The name of the organization, project, or laboratory from where the database is obtained (UniProt, NCBI, EBI, other). | STRING | ManifestColumn | ManifestColumn | |
| databaseVersion | The version of the database. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | STRING | ManifestColumn | ManifestColumn | |
| databaseWeblink | An internet address that may provide details of a database or software search, as well as for labs that generate their own search method (web link). Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | STRING | ManifestColumn | ManifestColumn | |
| diagnosisStatus | Whether the individual has been diagnosed with a condition or disease (physical and/or cognitive), \True" indicates the individual has been diagnosed" | FALSE,TRUE | STRING | ManifestColumn | ManifestColumn |
| digestionMethod | The type of digestion (ex. in-solution, in-gel)Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | STRING | ManifestColumn | ManifestColumn | |
| digestionReagent | Enzymes or reagents used for digestion. | 2-iodobenzoate,Arg-C,Asp-N,Asp-N_ambic,Chymotrypsin,CNBr,Formic_acid,Glutamyl endopeptidase,Leukocyte elastase,Lys-C,Lys-C/P,No cleavage,NoEnzyme,Not applicable,Not available,Not collected,Not specified,PepsinA,Proline endopeptidase,TrypChymo,Trypsin,Trypsin/P,Unknown,Unspecific cleavage,V8-DE,V8-E | STRING | ManifestColumn | ManifestColumn |
| dnaBatchID | DNA isolation batch identifier, provided by the data contributor to Sage Bionetworks. The batch identifier(s) must be stored in a data dictionary .csv file uploaded to Synapse. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | STRING | ManifestColumn | ManifestColumn | |
| dnaBatchSize | The number of samples. Provide a value or Unknown Not collected Not applicable Not specified | STRING | ManifestColumn | ManifestColumn | |
| dnaBatchSizeUnit | The unit of measurement for number of samples in a batch | AFU,AI,AU/ml,bp g/dl,DK units/ml,g/l,gm,HAU,IU,iu/l,IU/ml,Kallikrein Inactivator Unit per Milliliter,kg,l,M,mg,mg/dl,mg/l,mg/ml,miu/ml,ml,mM,MOI,ng,ng/dl,ng/ml,ng/nl,ng/ul,nl,nM,Not specified,NPX,optical density,other,PFU,PFUe,pg,pg/mg creatinine,pg/ml,pg/nl,pg/ul,pl,pM,Pound,TCID50,ug,ug/dl,ug/l,ug/ml,ug/ul,uiu/ml,ul,uM,umol/l,units/ml,Unknown,Not collected,Not applicable,Not specified | STRING | ManifestColumn | ManifestColumn |
| enrichment | Protocol or reagent used for enrichment (ex. Fe3+NTA-Agarose (Qiagen)Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | STRING | ManifestColumn | ManifestColumn | |
| enrichmentMethod | The method used for performing an enrichment of specific regions by a restriction enzyme digest. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | STRING | ManifestColumn | ManifestColumn | |
| enrichmentStrategy | Type of peptide or protein enrichment | Acetylome Proteome,Glycoproteome,Lipidome,Metabolome,Not applicable,Not available,Not collected,Not specified,Phosphoproteome,Ubiquitylome,Unknown | STRING | ManifestColumn | ManifestColumn |
| ethnicGroupCode | A coded value specifying the self-declared ethnic origination independent of racial origination, provided by the data contributor's data dictionary | STRING | ManifestColumn | ManifestColumn | |
| experimentType | The type of experiment used. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | STRING | ManifestColumn | ManifestColumn | |
| experimentalBatchSizeUnit | The unit of measurement for number of samples in a experimental batch | STRING | ManifestColumn | ManifestColumn | |
| experimentalFactor | Variable aspects of an experiment design that can be used to describe an experiment or set of experiments in an increasingly detailed manner.This field accepts ontology terms from Experimental Factor Ontology (EFO) and/or Ontology for Biomedical Investigations (OBI). Example - 'time series design [EFO-0001779]'Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | STRING | ManifestColumn | ManifestColumn | |
| extractionMethod | The name of the process used to separate a desired component of an input material from the remainder. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | STRING | ManifestColumn | ManifestColumn | |
| fieldCenterCode | Name of the field center | STRING | ManifestColumn | ManifestColumn | |
| fileFormat | Defined format of the data file, typically corresponding to extension, but sometimes indicating more general group of files produced by the same tool or software | FASTQ, FASTA, SAM, BAM, CRAM, VCF, BCF, GTF, GFF, GFF3, BED, BigBed, WIG, BigWig, CSV, TSV, MTX, H5AD, LOOM, RDS,PED, MAP, BED_PLINK, TPED, TFAM, BEDGRAPH, NARROWPEAK, BROADPEAK, TAGALIGN, OME-TIFF, ND2, CZI, LSM, H5, HDF5, PARQUET, PDB, MMCIF, JSON, YAML, XML, TXT, XLSX, CSV, Not assigned | STRING | ManifestColumn | ManifestColumn |
| fractionIdentifier | Number of fractions in the experimental runProvide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | STRING | ManifestColumn | ManifestColumn | |
| gasFlowTemperature | e.g., nebulization gas, cone gas, etc.Unit of measure-C, F, K, Not specified | NUMBER | ManifestColumn | ManifestColumn | |
| gasFlowTemperatureUnit | Unit of gas flow temperature | C,F,K | STRING | ManifestColumn | ManifestColumn |
| genotypeTechnology | Method(s) used to genotype variants in the discovery stage. Separate multiple methods separated by a semicolon (;). Example - genome-wide genotyping array, exome-wide sequencing, targeted genotyping array | STRING | ManifestColumn | ManifestColumn | |
| hasAssayControl | Boolean flag indicating whether or not a specimen is a technical or assay control. Examples include study pools or reference pools, blanks, or internal standards. | BOOLEAN | ManifestColumn | ManifestColumn | |
| hasIonizationSource | Were the ionization conditions recorded to enable reproduction of the experiment? | No,Yes | BOOLEAN | ManifestColumn | ManifestColumn |
| imputation | Were SNPs imputed for the discovery GWAS? | STRING | ManifestColumn | ManifestColumn | |
| imputationPanel | Panel used for imputation. Example - 1000 Genomes Phase 3 | STRING | ManifestColumn | ManifestColumn | |
| imputationSoftware | Imputation software. Example - IMPUTE | STRING | ManifestColumn | ManifestColumn | |
| instrumentModel | The model of the instrument used. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | STRING | ManifestColumn | ManifestColumn | |
| ionProperty | Ion charge state (positive or negative-ion analysis) | Negative,Positive | STRING | ManifestColumn | ManifestColumn |
| isobaricLabelingReagent | Reagent set used for isobaric labeling. Examples- iTRAQ113 TMT126Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | STRING | ManifestColumn | ManifestColumn | |
| labelFreeQuantitation | Type of label-free data analysis strategyProvide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | Label-free gene level quantitation,Label-free peptide level quantitation,Label-free protein group level quantitation,Label-free protein level quantitation,Label-free raw feature quantitation,Not applicable,Not available,Not collected,Not specified,Unknown | STRING | ManifestColumn | ManifestColumn |
| labelQuantitation | Type of labeling usedProvide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | AminoxyTMT,DiART,DiLeu,Glyco-TMT,Hydrazide TMT,IodoTMT,IPTL,iTRAQ,iTRAQH,Label Free,Not available,Not collected,Not specified,TMT,Unknown | STRING | ManifestColumn | ManifestColumn |
| lensVoltages | The skimmer/focusing lens voltages e.g., capillary voltage, etc. | NUMBER | ManifestColumn | ManifestColumn | |
| lensVoltagesUnit | Unit of lens voltages | STRING | ManifestColumn | ManifestColumn | |
| libLayout | Library layout. Specify whether to expect single, paired, or other configurations of reads. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | STRING | ManifestColumn | ManifestColumn | |
| libReadsSeqd | Library reads sequenced. Total number of clones sequenced from the library. Example - '20'Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | INTEGER | ManifestColumn | ManifestColumn | |
| libSize | Library size. Total number of clones in the library prepared for the project. Example - '50'Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | INTEGER | ManifestColumn | ManifestColumn | |
| libVector | Library vector. Cloning vector type(s) used in the construction of libraries. Example - 'Bacteriophage P1'Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | STRING | ManifestColumn | ManifestColumn | |
| libraryBatchID | Library batch identifier, provided by the data contributor to Sage Bionetworks. The batch identifier(s) must be stored in a data dictionary .csv file uploaded to Synapse. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | STRING | ManifestColumn | ManifestColumn | |
| lifeStage | The life stage of the individual.note- Other values are possible depending on life stage terminology for individual species. Please let the data curation team know. | Adult,Juvenile,Post-Juvenile, Not applicable, Not collected, Not specified, Other, Unknown | STRING | ManifestColumn | ManifestColumn |
| measurementTechnique | The name of the measurement technique describing the assay method. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | Bisulfite sequencing,Clinical data,Genome-wide association study,High-performance liquid chromatography tandem mass spectrometry,Liquid chromatography mass spectrometry,Liquid chromatography tandem mass spectrometry,Mass spectrometry,Metabolomics,MetaX-processed metabolomics data,Proximity extension assay,RNA sequencing,Single-cell RNA sequencing,Shotgun metagenomic sequencing,Single nucleotide polymorphism array,Tandem Mass Tag proteomics,Whole-genome sequencing,Unknown,Other,Not collected,Not applicable,Not specified | STRING | ManifestColumn | ManifestColumn |
| mid | Multiplex identifiers. Molecular barcodes, called Multiplex Identifiers (MIDs), are used to tag unique samples in a sequencing run specifically. Sequence should be reported in uppercase letters. Example - 'GTGAATAT'Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | STRING | ManifestColumn | ManifestColumn | |
| modificationParameters | Modification parameters for a search engine run. (ex. PSI- PI http-//www.w3.org/2002/07/owl#Axiom) or used in the peptide identification database search. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | STRING | ManifestColumn | ManifestColumn | |
| msAnalyteType | The type of biospecimen subjected to analysis (ex., peptide, protein, metabolite, lipid)Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | STRING | ManifestColumn | ManifestColumn | |
| msAssayTechnique | Specified the mass spectrometer technique used or the name of the proteomics assay used (ex. DDA)Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | STRING | ManifestColumn | ManifestColumn | |
| msTarget | Specifies whether or not a specific molecule(s) is/are targeted for detection/measurement by the assay | Not applicable,Not available,Not collected,Not specified,Targeted,Unknown,Untargeted | STRING | ManifestColumn | ManifestColumn |
| nucleAcidExt | Nucleic acid extraction. A link to a literature reference, electronic resource or a standard operating procedure (SOP), that describes the material separation to recover the nucleic acid fraction from a sample. (example, https-//mobio.com/media/wysiwyg/pdfs/protocols/12888.pdf). Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | STRING | ManifestColumn | ManifestColumn | |
| numberContig | Number of contigs. Total number of contigs in the cleaned/submitted assembly that comprise a given genome, SAG, MAG, or UViG. Example - '40'Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | INTEGER | ManifestColumn | ManifestColumn | |
| numberIndividuals | Number of individuals in a group. Example - 2000 | INTEGER | ManifestColumn | ManifestColumn | |
| processingBatchID | Processing batch identifier, provided by the data contributor to Sage Bionetworks. The batch identifier(s) must be stored in a data dictionary .csv file uploaded to Synapse | STRING | ManifestColumn | ManifestColumn | |
| program | ELITE,AD | STRING | ManifestColumn | ManifestColumn | |
| projectShortName | LC,ILO,LLFS,LG, Not assigned | STRING | ManifestColumn | ManifestColumn | |
| quantationStrategy | The general strategy used for differential analysis Example - Absolute quantitation analysis, Isobaric label quantitation analysis, LC-MS label-free quantitation analysis,Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | STRING | ManifestColumn | ManifestColumn | |
| readLengthUnits | The units of measurement. Provide a value or Unknown Not collected Not applicable Not specified | STRING | ManifestColumn | ManifestColumn | |
| readmeFile | The name of any readme file uploaded to Synapse. Example - example.tsv | STRING | ManifestColumn | ManifestColumn | |
| reagentCatalogNumber | If the assay reagent is a commercial product, enter the vendor's catalog identifier. If the reagent is a custom preparation enter 'NA'. | STRING | ManifestColumn | ManifestColumn | |
| reagentContact | The contact information is particularly helpful when the reagent is not from a commercial vendor. | STRING | ManifestColumn | ManifestColumn | |
| reagentIDs | One or more identifiers, separated by a semicolon (;). The reagent identifier(s) must be stored in a data dictionary .csv file uploaded to Synapse. | STRING | ManifestColumn | ManifestColumn | |
| reagentLotNumber | The lot number is often provided by a reagent source when the reagent is replenished over time. | STRING | ManifestColumn | ManifestColumn | |
| reagentManufacturer | The manufacturer is the source of a reagent and may include commercial vendors as well as non-commercial sources (e.g., collaborating labs). | STRING | ManifestColumn | ManifestColumn | |
| reagentName | The reagent name is an alternative to the Reagent ID. | STRING | ManifestColumn | ManifestColumn | |
| reagentWeblink | An internet address that may provide details of an assay reagent. | STRING | ManifestColumn | ManifestColumn | |
| referenceTranscriptID | The ID for the transcript/gene. Either the NCBI ID or the Ensembl ID must be provided. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | STRING | ManifestColumn | ManifestColumn | |
| reportedTrait | The trait under investigation. Please describe the trait concisely but with enough detail to be clear to a non-specialist. Avoid the use of abbreviations; if these are necessary, please define them or their source in the readme file. Example - Reticulocyte count | STRING | ManifestColumn | ManifestColumn | |
| repositoryName | The public repository name for the transcript (for example, Ensembl or NCBI Gene) | ArrayExpress,Broad Single Cell Portal,dbGAP,ENA,Ensembl,FlowRepository,GenBank,GENCODEv38,GRCh38,GEO,GISAID,IEDB,ImmPort,MassIVE,MetaboLights,Metabolomics Workbench,MGnify,NCBI Gene,PRIDE,SRA,Synapse,UniProt,Other,Unknown,Not collected,Not applicable,Not specified | STRING | ManifestColumn | ManifestColumn |
| resourceType | The type of resource being stored and annotated | experimentalData,metadata,tool,analysis,computationalNotebook,softwareTool,Not assigned | STRING | ManifestColumn | ManifestColumn |
| resultUnit | The unit for the result value | FPKM,raw count, Not applicable,Not collected,Not specified,RPKM,TPM,Unknown | STRING | ManifestColumn | ManifestColumn |
| rnaBatchID | Isolation batch identifier, provided by the data contributor to Sage Bionetworks. The batch identifier(s) must be stored in a data dictionary .csv file uploaded to Synapse. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | STRING | ManifestColumn | ManifestColumn | |
| rnaBatchSize | The number of samples | NUMBER | ManifestColumn | ManifestColumn | |
| rnaBatchSizeUnit | The unit of measurement for number of samples in a batch | AFU,AI,AU/ml,bp g/dl,DK units/ml,g/l,gm,HAU,IU,iu/l,IU/ml,Kallikrein Inactivator Unit per Milliliter,kg,l,M,mg,mg/dl,mg/l,mg/ml,miu/ml,ml,mM,MOI,ng,ng/dl,ng/ml,ng/nl,ng/ul,nl,nM,Not specified,NPX,optical density,other,PFU,PFUe,pg,pg/mg creatinine,pg/ml,pg/nl,pg/ul,pl,pM,Pound,TCID50,ug,ug/dl,ug/l,ug/ml,ug/ul,uiu/ml,ul,uM,umol/l,units/ml | STRING | ManifestColumn | ManifestColumn |
| sampleBatchID | Sample batch lot identifier, provided by the data contributor to Sage Bionetworks. The batch identifier(s) must be stored in a data dictionary .csv file uploaded to Synapse | STRING | ManifestColumn | ManifestColumn | |
| sampleIntroduction | The sample introduction and delivery. From GC, from LC, direct infusion without chromatography, direct infusion using dedicated autosampler flow rate. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | STRING | ManifestColumn | ManifestColumn | |
| samplePrepProtocol | An internet address that may provide more details of the protocol information (web link). Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | STRING | ManifestColumn | ManifestColumn | |
| sampleType | The type of sample collected or the term used to describe the source of a biospecimen used for a laboratory test. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | STRING | ManifestColumn | ManifestColumn | |
| seqMethod | Sequencing method. Sequencing method used; Example - 'Sanger, pyrosequencing, ABI-solid'. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | STRING | ManifestColumn | ManifestColumn | |
| seqPlatform | Sequencing platform information. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | STRING | ManifestColumn | ManifestColumn | |
| sequencingBatchID | Sequencing batch identifier, provided by the data contributor to Sage Bionetworks. The batch identifier(s) must be stored in a data dictionary .csv file uploaded to Synapse. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | STRING | ManifestColumn | ManifestColumn | |
| sequencingBatchSize | The number of samples. Provide a value or Unknown Not collected Not applicable Not specified | STRING | ManifestColumn | ManifestColumn | |
| sequencingBatchSizeUnit | The unit of measurement for number of samples in a batch. Provide a value or Unknown Not collected Not applicable Not specified | STRING | ManifestColumn | ManifestColumn | |
| sop | Relevant standard operating procedures. Standard operating procedures used in the assembly and/or annotation of genomes, metagenomes, or environmental sequences. Example - 'http-//press.igsb.anl.gov/earthmicrobiome/protocols-and-standards/its/)'Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | STRING | ManifestColumn | ManifestColumn | |
| sourceMatID | Source material identifiers. A unique identifier assigned to a material sample (as defined by http-//rs.tdwg.org/dwc/terms/materialSampleID and as opposed to a particular digital record of a material sample) used for extracting nucleic acids, and subsequent sequencing.The identifier can refer to the original material collected or any derived sub-samples. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | STRING | ManifestColumn | ManifestColumn | |
| speciesAge | Age of individual (formatted in months, ex. "72 months").note- Uncertainty about the age might require recording age by specifying a lower and upper estimate in months for the age of the animal. | STRING | ManifestColumn | ManifestColumn | |
| speciesGroup | The taxonomic ranking including both species and subspecies the individual belongs to. | Amphibian,Bird,Fish,Invertebrate,Mammal,Not applicable,Not collected,Not specified,Reptile,Unknown | STRING | ManifestColumn | ManifestColumn |
| speciesName | The scientific name of the species (typically a taxonomic group, ex. "Eremophila alpestris) the individual belongs to.""" | Abramis brama, Acanthisitta chloris, Accipiter cooperii, Accipiter gentilis, Accipiter nisus, Acipenser naccarii, Acipenser ruthenus, Acomys cahirinus, Acomys russatus, Acridotheres tristis, Actitis macularius, Aegithalos caudatus, Aix sponsa, Alca torda, Alligator mississippiensis, Alopochen aegyptiaca, Alosa sapidissima, Amblyraja radiata, Ammodramus caudacutus, Ammodytes marinus, Ammospiza nelsoni, Anabas testudineus, Anableps anableps, Anas acuta, Anas carolinensis, Anas crecca, Anas platyrhynchos, Anguilla anguilla, Anser albifrons, Anser anser, Anser brachyrhynchus, Anser erythropus, Anser fabalis, Antennarius maculatus, Antigone canadensis, Aplidium turbinatum, Aplochiton taeniatus, Apodemus sylvaticus, Apus apus, Aquila chrysaetos, Ara ararauna, Archilochus colubris, Archocentrus centrarchus, Argentina silus, Artibeus intermedius, Artibeus jamaicensis, Artibeus lituratus, Arvicanthis niloticus, Arvicola amphibius, Ascaphus truei, Ascidia mentula, Ascidiella aspersa, Astatotilapia calliptera, Asterias rubens, Athene noctua, Aythya ferina, Aythya fuligula, Aythya marila, Baeolophus bicolor, Balaena mysticetus, Balaenoptera acutorostrata, Balaenoptera borealis, Balaenoptera musculus, Balaenoptera physalus, Balearica regulorum, Barbatula barbatula, Barbus barbus, Bathysaurus mollis, Benthalbella elongata, Blarina brevicauda, Blennius ocellaris, Bombina bombina, Bombina variegata, Bombycilla cedrorum, Bonasa umbellus, Borostomias antarcticus, Bos taurus, Branchiostoma lanceolatum, Branta canadensis, Branta leucopsis, Bubo virginianus, Bucephala clangula, Bucorvus abyssinicus, Bufo bufo, Buglossidium luteum, Buteo buteo, Buteo jamaicensis, Buteo lineatus, Callithrix jacchus, Calonectris borealis, Calypte anna, Canis latrans, Canis lupus, Caprimulgus europaeus, Carassius carassius, Carcharodon carcharias, Cardinalis cardinalis, Caretta caretta, Cariama cristata, Carollia sowelli, Castor canadensis, Catharus ustulatus, Cavia porcellus, Cepola macrophthalma, Cervus elaphus, Cetorhinus maximus, Chanos chanos, Charadrius vociferus, Chelidonichthys cuculus, Chelidonichthys lucerna, Chelmon rostratus, Chelon labrosus, Chelonia mydas, Chinchilla lanigera, Chionoecetes opilio, Chionomys nivalis, Chiroxiphia lanceolata, Choloepus didactylus, Chroicocephalus ridibundus, Ciconia maguari, Ciliata mustela, Cinclus cinclus, Clangula hyemalis, Clavelina lepadiformis, Colius striatus, Coloeus monedula, Columba livia, Columba palumbus, Condylura cristata, Conger conger, Copsychus sechellarum, Coregonus lavaretus, Corella eumyota, Corvus brachyrhynchos, Corvus hawaiiensis, Corvus moneduloides, Cottoperca gobio, Cricetomys ansorgei, Cricetulus barabensis, Cricetulus griseus, Cryptomys damarensis, Cuculus canorus, Cuniculus paca, Cyanistes caeruleus, Cyanocitta cristata, Cyclopterus lumpus, Cygnus columbianus, Cygnus cygnus, Cygnus olor, Cynocephalus volans, Danio rerio, Dasypus novemcinctus, Delphinus delphis, Dendrocygna viduata, Dendropsophus ebraccatus, Denticeps clupeoides, Dermanura phaeotis, Dermochelys coriacea, Diceros bicornis, Diplecogaster bimaculata, Discoglossus pictus, Dromiciops gliroides, Dryobates pubescens, Dumetella carolinensis, Echeneis naucrates, Echiichthys vipera, Electrona antarctica, Electrona carlsbergi, Electrona subaspera, Electrophorus electricus, Elephas maximus, Ellobius lutescens, Ellobius talpinus, Emys orbicularis, Eonycteris spelaea, Eptesicus chiriquinus, Eptesicus furinalis, Eptesicus fuscus, Eptesicus nilssonii, Equus caballus, Eremophila alpestris, Erethizon dorsatum, Eretmochelys imbricata, Erinaceus europaeus, Erithacus rubecula, Erpetoichthys calabaricus, Erythrolamprus reginae, Eschrichtius robustus, Esox lucius, Eubalaena glacialis, Euleptes europaea, Eutrigla gurnardus, Falco biarmicus, Falco cherrug, Falco naumanni, Falco peregrinus, Falco punctatus, Falco rusticolus, Falco tinnunculus, Ficedula hypoleuca, Fringilla coelebs, Fukomys damarensis, Fulica atra, Fundulus diaphanus, Gadus morhua, Gaidropsarus vulgaris, Gallinula chloropus, Gallus gallus, Gardnerycteris keenani, Gasterosteus aculeatus, Gastrophryne carolinensis, Gavia stellata, Geothlypis trichas, Geotrypetes seraphini, Globicephala melas, Glossophaga mutica, Gobio gobio, Gobius niger, Gopherus evgoodei, Gopherus flavomarginatus, Gouania willdenowi, Grampus griseus, Grus americana, Grus grus, Gulosus aristotelis, Gymnoscopelus braueri, Gymnoscopelus microlampas, Gypaetus barbatus, Haematopus ostralegus, Haemorhous mexicanus, Haliaeetus albicilla, Halichoerus grypus, Harpagifer antarcticus, Harpia harpyja, Hemiprocne comata, Hemiscyllium ocellatum, Heterocephalus glaber, Heterohyrax brucei, Hippoglossus hippoglossus, Hipposideros larvatus, Hirundo rustica, Homo sapiens, Hoplias malabaricus, Hydrochoerus hydrochaeris, Hydroprogne caspia, Hylocichla mustelina, Hypanus sabinus, Hyperolius riggenbachi, Hyperoodon ampullatus, Hyperoplus immaculatus, Hypomesus transpacificus, Ia io, Icteria virens, Jaculus jaculus, Labrus bergylta, Labrus mixtus, Lacerta agilis, Lagenorhynchus acutus, Lagenorhynchus albirostris, Lampanyctus macdonaldi, Lampetra fluviatilis, Larus argentatus, Larus canus, Larus delawarensis, Larus fuscus, Larus glaucescens, Larus marinus, Larus michahellis, Larus occidentalis, Lathamus discolor, Lemur catta, Lepidochelys kempii, Leptodactylus fuscus, Leuciscus leuciscus, Liasis olivaceus, Limanda limanda, Lipophrys pholis, Lissotriton helveticus, Lissotriton vulgaris, Lophostoma evotis, Lutra lutra, Lynx canadensis, Macaca fascicularis, Macaca mulatta, Macropus eugenii, Malaclemys terrapin, Malacosteus niger, Manis pentadactyla, Mareca strepera, Marmota monax, Martes martes, Mastacembelus armatus, Megalops cyprinoides, Melanerpes carolinus, Melanostigma gelatinosum, Melanotaenia boesemani, Meleagris gallopavo, Meles meles, Melopsittacus undulatus, Melospiza georgiana, Melospiza melodia, Mergellus albellus, Mergus serrator, Meriones unguiculatus, Merops nubicus, Mesocricetus auratus, Mesoplodon bidens, Mesoplodon densirostris, Mesoplodon mirus, Microcaecilia unicolor, Microchirus variegatus, Micromesistius poutassou, Micromys minutus, Micronycteris microtis, Microstomus kitt, Microtus pennsylvanicus, Milvus milvus, Mimus polyglottos, Miniopterus schreibersii, Molossus alvarezi, Molossus molossus, Molossus nigricans, Molothrus ater, Monodelphis domestica, Multi-species, Muntiacus reevesi, Mus musculus, Muscardinus avellanarius, Mustela erminea, Mustela nivalis, Mustelus asterias, Myocastor coypus, Myodes glareolus, Myotis daubentonii, Myotis emarginatus, Myotis lucifugus, Myotis myotis, Myotis mystacinus, Myotis nattereri, Myotis nesopolus, Myotis pilosatibialis, Myotis tricolor, Myripristis murdjan, Myxine glutinosa, Nannobrachium achirus, Nannospalax galili, Nansenia antarctica, Natrix helvetica, Neoarius graeffei, Neofelis nebulosa, Neosciurus carolinensis, Neotoma cinerea, Neotoma floridana, Neovison vison, Nesoenas mayeri, Netta rufina, Nomonyx dominicus, Not applicable, Not collected, Not provided, Not specified, Notolabrus celidotus, Notolepis coatsi, Notothenia rossii, Numenius arquata, Nyctalus leisleri, Nyctibius grandis, Nycticebus coucang, Octodon degus, Odocoileus virginianus, Ondatra zibethicus, Ornithorhynchus anatinus, Oryctolagus cuniculus, Osmerus eperlanus, Osmerus mordax, Other, Otis tarda, Pagrus pagrus, Pan troglodytes, Pangasianodon hypophthalmus, Papio anubis, Parambassis ranga, Passer domesticus, Passerculus sandwichensis, Passerina caerulea, Passerina cyanea, Pelecanus crispus, Pelophylax lessonae, Periophthalmus magnuspinnatus, Peromyscus gossypinus, Peromyscus leucopus, Peromyscus maniculatus, Petromyzon marinus, Phaethon aethereus, Phalacrocorax auritus, Phalacrocorax carbo, Phasianus colchicus, Phocoena phocoena, Phocoena sinus, Phoenicopterus ruber, Pholidichthys leucotaenia, Pholis gunnellus, Phoxinus phoxinus, Phyllostomus discolor, Picoides villosus, Pipilo erythrophthalmus, Pipistrellus kuhlii, Pipistrellus nathusii, Pipistrellus pipistrellus, Pipistrellus pygmaeus, Platalea leucorodia, Platichthys flesus, Platyrrhinus helleri, Plecotus auritus, Pleuronectes platessa, Pluvialis apricaria, Podarcis bocagei, Podarcis cretensis, Podarcis filfolensis, Podarcis gaigeae, Podarcis liolepis, Podarcis melisellensis, Podarcis muralis, Podarcis pityusensis, Podarcis raffonei, Podarcis siculus, Podarcis tiliguerta, Podarcis vaucheri, Podargus strigoides, Poecile carolinensis, Pogoniulus pusillus, Pollachius pollachius, Porphyrio hochstetteri, Potamotrygon marinae, Pristis pectinata, Pseudophryne corroboree, Pseudorca crassidens, Pterocles gutturalis, Pygocentrus nattereri, Quiscalus quiscula, Rana temporaria, Rattus norvegicus, Rattus rattus, Regulus calendula, Rhea pennata, Rhinatrema bivittatum, Rhineura floridana, Rhinolophus ferrumequinum, Rhynochetos jubatus, Rissa tridactyla, Rousettus aegyptiacus, Saimiri boliviensis, Salarias fasciatus, Salmo trutta, Sayornis phoebe, Scalopus aquaticus, Scardinius erythrophthalmus, Scatophagus argus, Sciurus carolinensis, Sciurus niger, Sciurus vulgaris, Scleropages formosus, Scolopax minor, Scomber japonicus, Scyliorhinus canicula, Sebastes umbrosus, Setophaga citrina, Setophaga coronata, Setophaga dominica, Setophaga petechia, Setophaga pinus, Sialia sialis, Sigmodon hispidus, Sitta carolinensis, Sorex araneus, Sparus aurata, Spatula clypeata, Spea bombifrons, Sphaeramia orbicularis, Spheniscus humboldti, Spinus tristis, Spirinchus thaleichthys, Spizella passerina, Spizella pusilla, Spizelloides arborea, Sterna hirundo, Streptopelia turtur, Strigops habroptilus, Strix aluco, Struthio camelus, Sturnus vulgaris, Suncus etruscus, Sus scrofa, Sylvia atricapilla, Sylvia borin, Sylvilagus floridanus, Syngnathus acus, Tachycineta bicolor, Tachyglossus aculeatus, Taeniopygia guttata, Takifugu rubripes, Tamandua tetradactyla, Tamias striatus, Tamiasciurus hudsonicus, Tauraco erythrolophus, Taurulus bubalis, Tautogolabrus adspersus, Thalassophryne amazonica, Thamnophis elegans, Theristicus caerulescens, Thryothorus ludovicianus, Thunnus albacares, Thunnus maccoyii, Toxostoma rufum, Toxotes jaculatrix, Trachurus trachurus, Trichosurus vulpecula, Troglodytes aedon, Trogon surrucura, Turdus migratorius, Tursiops truncatus, Unknown, Vespertilio murinus, Vicugna pacos, Vidua chalybeata, Vipera latastei, Vireo griseus, Vireo olivaceus, Xenentodon cancila, Zalophus californianus, Zenaida macroura, Zeus faber, Zonotrichia albicollis | STRING | ManifestColumn | ManifestColumn |
| specimenAge | The subject's age at the time of specimen extraction is the individual's age (since birth) at the time a given specimen was extracted. Measured as age in years. Other, Unknown, Not collected, Not applicable | STRING | ManifestColumn | ManifestColumn | |
| specimenSource | Indicate the biological area of the specimen | human, wild, captive, not applicable, not collected, other, unknown | STRING | ManifestColumn | ManifestColumn |
| specimenType | Type of biological material sample taken from a biological entity for research purposes | blood, brain, buffy coat, cell line, cells, nervous system, organoid, plasma, saliva, serum, skin, stool, tissue, urine, Not applicable, Not collected, Not specified, Other, Unknown | STRING_LIST | ManifestColumn | ManifestColumn |
| stage | Stage of the experimental design. | Discovery,Not applicable,Not collected,Not specified,Other,Replication,Unknown | STRING | ManifestColumn | ManifestColumn |
| statisticalModel | A brief description of the statistical model used to determine association significance. It is important to distinguish studies that would otherwise appear identical (e.g., the same trait analyzed using additive, dominant, and recessive models). Example - additive model | STRING | ManifestColumn | ManifestColumn | |
| studyCode | Deprecated attribute - see studyKey | STRING | ManifestColumn | ManifestColumn | |
| studyKey | The short acronym for a study name in a URL-friendly format (ex. LLFS_Metabolomics OR ELPSCRNA) | STRING | ManifestColumn | ManifestColumn | |
| summaryFile | The name of any summary statistics file uploaded to Synapse. Example - example.tsv | STRING | ManifestColumn | ManifestColumn | |
| summaryStatisticsAssembly | Genome assembly for the summary statistics. Example - GRCh38 | STRING | ManifestColumn | ManifestColumn | |
| targetGene | Targeted gene or locus name for marker gene studies. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | STRING | ManifestColumn | ManifestColumn | |
| taxon | Taxonomic identifier. The National Center for Biotechnology Information taxon ID (formatted as, ex. "txid9989") | STRING | ManifestColumn | ManifestColumn | |
| technologyPlatformVersion | The specific version (application, manufacturer, model, lab, etc.) of a technology that is used to carry out a laboratory or computational experiment. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified | STRING | ManifestColumn | ManifestColumn | |
| tissueVolume | The volume of the tissue sample. Measured in microliters. | STRING | ManifestColumn | ManifestColumn | |
| transcriptType | The type of transcript reported | lincRNA,mRNA,total RNA minus rRNA,Not applicable,Not collected,Not specified,Other,snRNA,Unknown | STRING | ManifestColumn | ManifestColumn |
| treatmentAmountUnit | Unit of treatment amount. | AFU,AI,AU/ml,DK units/ml,g/dl,g/l,gm,HAU,IU,iu/l,IU/ml,Kallikrein Inactivator Unit per Milliliter,kg,l,M,mg,mg/dl,mg/l,mg/ml,miu/ml,ml,mM,MOI,ng,ng/dl,ng/ml,ng/nl,ng/ul,nl,nM,Not specified,NPX,optical density,other,PFU,PFUe,pg,pg/mg creatinine,pg/ml,pg/nl,pg/ul,pl,pM,Pound,TCID50,ug,ug/dl,ug/l,ug/ml,ug/ul,uiu/ml,ul,uM,umol/l,units/ml | NUMBER | ManifestColumn | ManifestColumn |
| treatmentAmountValue | The Amount Value indicates how much (concentration, mass, volume) of a treatment agent was applied to a sample. | STRING | ManifestColumn | ManifestColumn | |
| treatmentDurationUnit | Unit of treatment duration. | d.p.c.,Days,Hours,Minutes,Months,Not applicable,Not collected,Not specified,Seconds,Unknown,Weeks,Years | STRING | ManifestColumn | ManifestColumn |
| treatmentDurationValue | Duration of treatment. | NUMBER | ManifestColumn | ManifestColumn | |
| treatmentIDs | One or more identifiers, separated by a semicolon (;). The treatment identifier(s) must be stored in a data dictionary .csv file uploaded to Synapse. | STRING | ManifestColumn | ManifestColumn | |
| treatmentName | Treatments refer to in vitro modifications of samples. Three treatment types are supported- agent amount, duration, and temperature. The treatment name is an alternate identifier to the Treatment ID. | STRING | ManifestColumn | ManifestColumn | |
| treatmentTemperatureUnit | Unit of treatment temperature. | C,F,K,Not specified | STRING | ManifestColumn | ManifestColumn |
| treatmentTemperatureValue | Value of treatment temperature. | NUMBER | ManifestColumn | ManifestColumn | |
| useReadMeFile | Was a readme file uploaded to Synapse? | STRING | ManifestColumn | ManifestColumn | |
| useReagent | Was a reagent applied to the sample? | FALSE,TRUE | BOOLEAN | ManifestColumn | ManifestColumn |
| useSummaryFile | Was a summary statitics file uploded to Synapse? | STRING | ManifestColumn | ManifestColumn | |
| useTreatment | Was a treatment applied to the sample? | BOOLEAN | ManifestColumn | ManifestColumn | |
| vacuumPressure | The recorded vacuum pressure value | NUMBER | ManifestColumn | ManifestColumn | |
| vacuumPressureUnit | Unit of vacuum pressure value | AFU,AI,AU/ml,bp g/dl,DK units/ml,g/l,gm,HAU,IU,iu/l,IU/ml,Kallikrein Inactivator Unit per Milliliter,kg,l,M,mg,mg/dl,mg/l,mg/ml,miu/ml,ml,mM,MOI,ng,ng/dl,ng/ml,ng/nl,ng/ul,nl,nM,Not specified,NPX,optical density,PFU,PFUe,pg,pg/mg creatinine,pg/ml,pg/nl,pg/ul,pl,pM,Pound,TCID50,ug,ug/dl,ug/l,ug/ml,ug/ul,uiu/ml,ul,uM,umol/l,units/ml | STRING | ManifestColumn | ManifestColumn |
| valueReported | The count or gene count for the transcript | STRING | ManifestColumn | ManifestColumn | |
| variantCount | The number of variants analysed in the discovery stage (after QC). Example - 52500 | STRING | ManifestColumn | ManifestColumn | |
| visitCode | Indicate which longitudinal visit for the individual the data comes from, provided by the data contributor's data dictionary | NUMBER | ManifestColumn | ManifestColumn |